Bcl 2

Manufactured by Qiagen

Sourced in Germany

BCL-2 is a laboratory equipment product manufactured by Qiagen. It is a protein that plays a role in regulating apoptosis, or programmed cell death, in various cell types.

Automatically generated - may contain errors

Lab products found in correlation

Bcl xl, by Qiagen (4 mentions) Mmp 9, by Qiagen (4 mentions) Gapdh, by Qiagen (3 mentions) Survivin, by Qiagen (3 mentions) Bcl2 associated x (bax), by Qiagen (3 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Twist, by Qiagen (2 mentions) Gapdh primer, by Qiagen (2 mentions) Methyl thiazolyl tetrazolium (mtt), by Merck Group (2 mentions) Penicillin streptomycin antibiotic, by Thermo Fisher Scientific (2 mentions) Annexin 5 fitc apoptosis detection kit, by Merck Group (2 mentions) Mitotracker green, by Merck Group (2 mentions) Caspase 3 assay kit, by Qiagen (2 mentions) Hek 293, by Iranian Biological Resource Center (2 mentions) Revertra ace qpcr rt kit, by Toyobo (1 mentions) Quantifast sybr green pcr master mix, by Qiagen (1 mentions) Vimentin, by Qiagen (1 mentions) Ccnd1, by Qiagen (1 mentions) Nestin, by Qiagen (1 mentions) Nanog, by Qiagen (1 mentions)

9 protocols using bcl 2

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using a TRIzol Reagent (Invitrogen) and cDNA was synthesized using a ReverTra Ace^® qPCR RT Kit (Toyobo, Osaka Japan). Quantitative real-time PCR (qPCR) was performed using a QuantiFast SYBR Green PCR master mix (Qiagen, Valencia, CA, USA) with an Applied Biosystems 7300 (Life Technologies, Carlsbad, CA, USA). The data were analyzed by comparative C_t quantification and the value for each sample was normalized to the value for the housekeeping GAPDH gene. The primer pairs used in this experiment were BCL-2 (QT00025011), BCL-XL (QT00236712), SURVIVIN (QT01679664), MMP-2 (QT00088396), MMP-9 (QT00040040), FN (QT00038024), ITGAV (QT00051891), VIMENTIN (QT00095795), TWIST (QT00011956), CCND1 (QT00495285), MYC1 (QT00035406), NESTIN (QT01015301), SOX2 (QT00237601), NANOG (QT01844808), OCT4 (QT00210840), CD133 (QT00075586), and GAPDH (QT0007924) were obtained from Qiagen.

Kim B.H., Lee H., Park C.G., Jeong A.J., Lee S.H., Noh K.H., Park J.B., Lee C.G., Paek S.H., Kim H, & Ye S.K. (2020). STAT3 Inhibitor ODZ10117 Suppresses Glioblastoma Malignancy and Prolongs Survival in a Glioblastoma Xenograft Model. Cells, 9(3), 722.

+ Open protocol

+ Expand

Semi-quantitative RT-PCR Analysis of MMPs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using TRIzol Reagent (Invitrogen, Carlsbad, USA) and semi-quantitative RT-PCR was performed using AccuPower RT-PCR PreMix (Bioneer, Daejeon Korea) according to the manufacturer's protocol. Briefly, total RNA was reverse transcribed using a thermal cycler programmed at 42°C for 1 hour and PCR was performed with 30 cycles at 94°C for 30 seconds, 58°C for 30 seconds, and 72°C for 30 seconds, and a final extension step at 72°C for 5 minutes. The amplicons were resolved on agarose gels with DNA SafeStain (Lambda Biotech, St. Louis, USA) and visualized using a Gel Doc 2000 imaging system (Bio-Rad Laboratories, Hercules, USA). The primers used in this experiment were matrix metalloproteinase (MMP)-3 (QT00060025), MMP-9 (QT00040040), MMP-11 (QT00024031), Bcl-2 (QT00025011), Bcl-xL (QT00236712), SURVIVIN (QT01679664), and GAPDH (QT0007924) and were all obtained from Qiagen.

Kim B.H., Yi E.H., Li Y.C., Park I.C., Park J.Y, & Ye S.K. (2019). Anticancer Activity of Tubulosine through Suppression of Interleukin-6-Induced Janus Kinase 2/Signal Transducer and Activation of Transcription 3 Signaling. Journal of Breast Cancer, 22(3), 362-374.

+ Open protocol

+ Expand

Aortic Valve Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

From the other half of the harvested hearts, aortic roots (from annulus to sino‐tubular junction) containing the aortic valve, were isolated. RNA from the valve was extracted using RNeasy® Mini Kit (Qiagen, ON, Canada). Then PCR were performed with the use of the QX200 Droplet Digital PCR® system. The primers used for the PCR reaction were all from Qiagen (listed below). The Quantasoft software was used to analyze the data. The results of gene expression were normalized with the use of the average of expression of the three following housekeeping genes: hypoxanthine‐guanine phosphoribosyltransferase (HPRT1), Beta‐Actin, and Glyceraldehyde 3‐phosphate dehydrogenase (GAPDH).
Primers used:

BMP2: QT00012544 (Qiagen, Hilden, Germany)

BCl2: QT00156282 (Qiagen, Hilden, Germany)

Casp3: QT00260169(Qiagen, Hilden, Germany)

BGLAP: QT00259406 (Qiagen, Hilden, Germany)

RUNX2: QT00020517 (Qiagen, Hilden, Germany)

ALPL: QT00157717 (Qiagen, Hilden, Germany)

Wnt5a: QT00160958 (Qiagen, Hilden, Germany)

MMP9: QT00108815 (Qiagen, Hilden, Germany)

TIMP: forward 5‐tagtgatggttcccctcctc‐3, reverse 5‐tacttgtttgccatttccca‐3

AGRT1: QT00233548(Qiagen, Hilden, Germany)

TGFβ2: QT00058233 (Qiagen, Hilden, Germany)

TNFα: QT00115332(Qiagen, Hilden, Germany)

Fleury M., Annabi M., Voisine M., Hervault M., Boilard A., Shen M., Marette A., Côté N, & Clavel M. (2022). Impact of sex and sex hormones on pathophysiology and progression of aortic stenosis in a murine model. Physiological Reports, 10(16), e15433.

+ Open protocol

+ Expand

Cytotoxicity of Anti-Cancer Agents

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human colorectal adenocarcinoma (HT-29) and human embryonic kidney 293 (HEK-293) cell lines were purchased from Iranian Biological Resource Center (Tehran, Iran). The anti-cancer agents, 5-FU and DCA/3Br-P, were supplied by Ebewe Pharma company and Sigma Aldrich (Saint Louis, MO), respectively. Dulbecco’s modified eagle’s medium (DMEM), fetal bovine serum (FBS), phosphate-buffered saline (PBS), and antibiotic (penicillin-streptomycin) were purchased from Invitrogen Co, (Carlsbad, CA). Furthermore, MTT (3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide), 2,7-dichlorofluorescein diacetate (DCFH-DA), Annexin V/FITC apoptosis detection kit and MitoTracker Green supplied by Sigma Aldrich (Saint Louis, MO) were applied in this work. Moreover, Caspase 3 Assay kit, Bax, Bcl-2, and GAPDH primers were obtained from Qiagen (Hilden, Germany).

Nikravesh H., Khodayar M.J., Behmanesh B., Mahdavinia M., Teimoori A., Alboghobeish S, & Zeidooni L. (2021). The combined effect of dichloroacetate and 3-bromopyruvate on glucose metabolism in colorectal cancer cell line, HT-29; the mitochondrial pathway apoptosis. BMC Cancer, 21, 903.

+ Open protocol

+ Expand

Quantitative Analysis of Cancer Biomarkers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRIzol reagent and cDNA was synthesized using a ReverTra Ace^® qPCR RT Kit. Quantitative real-time PCR (qPCR) was performed using a QuantiFast SYBR Green PCR master mix with an Applied Biosystems 7300 thermocycler. Data were analyzed using comparative Ct quantification and the value for each sample was normalized to the value for the GAPDH gene. The primers used in this experiment were BCL-2 (QT00025011), BCL-XL (QT00236712), MCL-1 (QT00094122), SURVIVIN (QT01679664), MMP-2 (QT00088396), MMP-9 (QT00040040), TWIST (QT00011956), and GAPDH (QT0007924) were all obtained from Qiagen.

Kim B.H., Lee H., Song Y., Park J.S., Gadhe C.G., Choi J., Lee C.G., Pae A.N., Kim S, & Ye S.K. (2019). Development of Oxadiazole-Based ODZ10117 as a Small-Molecule Inhibitor of STAT3 for Targeted Cancer Therapy. Journal of Clinical Medicine, 8(11), 1847.

+ Open protocol

+ Expand

Gene Expression Analysis by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolation, purification, and reverse-transcription to cDNA were performed as instructed by the manufacturer (Qiagen, Hilden, Germany). Quantification of RNA was done with a NanoDrop ND-1000 spectrophotometer (Peqlab Biotechnologie GmbH, Erlangen, Germany). For quantitative real-time PCR (qRT-PCR), Fast SYBR Green Master Mix (Applied Biosystems, Darmstadt, Germany) was used on the 7500 Fast Real-Time PCR System (Applied Biosystems, Darmstadt, Germany). Gene expression analysis was performed with GAPH, Ifnα2, Ifnα4, Ifnα5, Ifnβ1, Usp18, Irf7, Isg15, Mx1, Bst2, Oas1, Irf1, and Bcl2 assays (Qiagen, Hilden, Germany). For analysis, the expression levels of all target genes were adjusted to GAPDH expression levels (ΔCt). Gene expression values were then calculated based on the delta-delta-Ct (ΔΔCt) method relative to the naive controls. Relative quantities (RQs) were determined using the following equation: RQ = 2^−ΔΔCt.

Cham L.B., Friedrich S.K., Adomati T., Bhat H., Schiller M., Bergerhausen M., Hamdan T., Li F., Machlah Y.M., Ali M., Duhan V., Lang K.S., Friebus-Kardash J, & Lang J. (2019). Tamoxifen Protects from Vesicular Stomatitis Virus Infection. Pharmaceuticals, 12(4), 142.

+ Open protocol

+ Expand

Reverse Transfection of Apoptosis Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were reverse-transfected with 10 nm of BAK (s1880 and s1881), BAX (s1888 and s1889), BIM (s195011), PUMA (pool of siRNAs), BMF (pool of siRNAs), BIK (s1989 and s1990), HRK (s194952), BCL-X_L (s1920), MCL-1 (s8583), BCL-w (s1924), BFL-1 (pool of siRNAs) from Life Technologies (Paisley, UK), BID (SI02654568), NOXA (SI00129430), BAD (SI00299348), BCL-2 (S100299411) from Qiagen (Manchester, UK) using Interferin (Polyplus Transfection, NY, USA), according to the manufacturer's protocol and processed 48 h after transfection. Immunoprecipitation and western blotting were carried out according to the standard protocols.^{26 (link)}

Lucas C.M., Milani M., Butterworth M., Carmell N., Scott L.J., Clark R.E., Cohen G.M, & Varadarajan S. (2016). High CIP2A levels correlate with an antiapoptotic phenotype that can be overcome by targeting BCL-XL in chronic myeloid leukemia. Leukemia, 30(6), 1273-1281.

+ Open protocol

+ Expand

Apoptosis Regulation in Megakaryocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative reverse transcription polymerase chain reaction (Q-RTPCR) was performed on RNA from day 11 megakaryocytes (both treated and untreated) using Power SYBR Green RNA-to-CT (Applied Biosystems, Grand Island, NY). The following primers were used: BAK, BAX, BNIP3, BNIP3L, BCL2, BCL-XL, IGF1R, CFLAR (all Qiagen, Germantown, MD). PCR reactions were performed on a Viia7 cycler (Applied Biosystems). The amount of mRNA for each sample was normalized using beta-actin as endogenous control.

Avanzi M.P., Izak M., Oluwadara O.E, & Mitchell W.B. (2015). Actin Inhibition Increases Megakaryocyte Proplatelet Formation through an Apoptosis-Dependent Mechanism. PLoS ONE, 10(4), e0125057.

+ Open protocol

+ Expand

Anticancer effects of 5-FU and DCA/3Br-P

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human colorectal adenocarcinoma (HT-29) and human embryonic kidney 293 (HEK-293) cell lines were purchased from Iranian Biological Resource Center (Tehran, Iran). The anti-cancer agents, 5-FU and DCA/3Br-P, were supplied by Ebewe Pharma company and Sigma Aldrich (Saint Louis, MO), respectively. Dulbecco's modi ed eagle's medium (DMEM), fetal bovine serum (FBS), phosphate-buffered saline (PBS), and antibiotic (penicillin-streptomycin) were purchased from Invitrogen Co, (Carlsbad, CA). Furthermore, MTT (3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide), 2,7-dichloro uorescein diacetate (DCFH-DA), Annexin V/FITC apoptosis detection kit and MitoTracker Green supplied by Sigma Aldrich (Saint Louis, MO) were applied in this work. Moreover, Caspase 3 Assay kit, Bax, Bcl-2, and GAPDH primers were obtained from Qiagen (Hilden, Germany).

Nikravesh H., Khodayar M.J., Behmanesh B., Mahdavinia M., Teimoori A., Alboghobeish S., & Zeidooni L. (2021). The Combined Effect of Dichloroacetate and 3-Bromopyruvate in Colorectal Cancer Cell Line, HT-29; The Mitochondrial Pathway Apoptosis.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!