Bcl 2
BCL-2 is a laboratory equipment product manufactured by Qiagen. It is a protein that plays a role in regulating apoptosis, or programmed cell death, in various cell types.
Lab products found in correlation
9 protocols using bcl 2
Quantitative Gene Expression Analysis
Semi-quantitative RT-PCR Analysis of MMPs
Aortic Valve Gene Expression Analysis
Primers used:
BMP2: QT00012544 (Qiagen, Hilden, Germany)
BCl2: QT00156282 (Qiagen, Hilden, Germany)
Casp3: QT00260169(Qiagen, Hilden, Germany)
BGLAP: QT00259406 (Qiagen, Hilden, Germany)
RUNX2: QT00020517 (Qiagen, Hilden, Germany)
ALPL: QT00157717 (Qiagen, Hilden, Germany)
Wnt5a: QT00160958 (Qiagen, Hilden, Germany)
MMP9: QT00108815 (Qiagen, Hilden, Germany)
TIMP: forward 5‐tagtgatggttcccctcctc‐3, reverse 5‐tacttgtttgccatttccca‐3
AGRT1: QT00233548(Qiagen, Hilden, Germany)
TGFβ2: QT00058233 (Qiagen, Hilden, Germany)
TNFα: QT00115332(Qiagen, Hilden, Germany)
Cytotoxicity of Anti-Cancer Agents
Quantitative Analysis of Cancer Biomarkers
Gene Expression Analysis by qRT-PCR
Reverse Transfection of Apoptosis Regulators
Apoptosis Regulation in Megakaryocytes
Anticancer effects of 5-FU and DCA/3Br-P
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!