DamID-seq was performed as described with some modifications (84 (link)). In brief, the Dam and Dam-EMD lentiviruses generated from HEK293T cells were concentrated by ultracentrifugation at 19,400 × g for 2.5 h. The virus pellets were resuspended in PBS. BMAL1+/+ and BMAL1–/– hMPCs were seeded in six-well dishes at 2 × 105 cells per well. Each group had three biological replicates. The next day, the culture medium was replaced with 2 ml of fresh culture medium containing either Dam or Dam-EMD lentivirus. At 72 h after transduction, cells were harvested, and genomic DNA was isolated using a TIANamp Genomic DNA Kit (Tiangen, DP304). DpnI enzyme (R0176S, New England Biolabs) digestion, adaptor ligation, DpnII enzyme (R0543S, New England Biolabs) digestion, PCR amplification and purification were performed as previously described (84 (link)). For adaptor trimming, the amplified DNA was sonicated and digested with AlwI (R0513S, New England Biolabs) enzyme. The DNA library was constructed using a NEBNext® Ultra™ DNA library prep Kit for Illumina® (E7370S, New England Biolabs). The libraries were pooled and subjected to paired-end sequencing with 150-bp read length on Illumina NovaSeq 6000 platform by Annoroad Gene Technology Company (Beijing, China).
Dpnii enzyme
Manufactured by New England Biolabs
Sourced in United States
DpnII is a type II restriction enzyme that recognizes and cleaves the palindromic DNA sequence 5'-GATC-3'. It is commonly used in molecular biology applications for the fragmentation of DNA samples.
Automatically generated - may contain errors
Lab products found in correlation
T4 dna ligase, by Thermo Fisher Scientific (5 mentions)
Qubit assay, by Thermo Fisher Scientific (3 mentions)
Nextera adapter, by Illumina (3 mentions)
Hindiii enzyme, by New England Biolabs (3 mentions)
Hiseq 4000, by Illumina (2 mentions)
Biotin 14 datp, by Thermo Fisher Scientific (2 mentions)
Nebnext ultra 2 dna library preparation kit, by New England Biolabs (2 mentions)
Protease inhibitor, by Roche (2 mentions)
Novaseq 6000 platform, by Illumina (1 mentions)
Tianamp genomic dna kit, by Tiangen Biotech (1 mentions)
Dpni enzyme, by New England Biolabs (1 mentions)
T4 dna ligase, by New England Biolabs (1 mentions)
Dynabeads myone streptavidin t1 beads, by Thermo Fisher Scientific (1 mentions)
Nebnext multiplex oligos for kit, by Illumina (1 mentions)
Nextseq 500, by Illumina (1 mentions)
2100 bioanalyzer, by Agilent Technologies (1 mentions)
Novaseq 6000, by Illumina (1 mentions)
Ampure xp bead, by Beckman Coulter (1 mentions)
Nebnext ultra 2 q5 master mix, by New England Biolabs (1 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions)
11 protocols using dpnii enzyme
1
DamID-seq Analysis of BMAL1 in hMPCs
2
High-throughput Chromatin Interaction Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hi-C libraries were processed with our in-house pipeline based on the previously published in situ protocol (Rao et al. 2014 (link)). Briefly, ~ 1 million cells were fixed in 2% formaldehyde, lysed and digested overnight with DpnII enzyme (New England BioLabs). Next, digested DNA ends were marked with biotin-14-dATP (Thermo Fisher Scientific) and ligated overnight using T4 DNA ligase (New England BioLabs). DNA was sheared to fragments of 300–500 bp for library preparation and biotin-filled DNA fragments were pulled down using Dynabeads MyOne Streptavidin T1 beads (Thermo Fisher Scientific). The DNA was prepared for short reads sequencing by ligating adaptors to the DNA fragments, using the NEBNext Multiplex Oligos for Illumina kit (New England BioLabs). Libraries were deep sequenced (~ 240 Million fragments) in a 75 bp paired-end run on a HiSeq4000 (Illumina). Paired-end sequencing data were processed using the Juicer pipeline (Durand et al. 2016 (link)). A detailed protocol is described elsewhere (Melo et al. 2020 (link)).
3
In situ Hi-C protocol for chromatin structure analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In situ Hi-C experiments were performed according to Concia et al.3 (link) using DpnII enzyme (New England Biolabs). DNA libraries were prepared using NEBNext Ultra II DNA library preparation kit (NEB) according to the manufacturer’s instructions (10 cycles for the PCR amplification step). DNA libraries were checked for quality and quantified using a 2100 Bioanalyzer (Agilent) and the libraries were subjected to 2 × 75 bp high-throughput sequencing by NextSeq 500 (Illumina). Two independent biological replicates were generated.
4
4C-seq Chromatin Conformation Capture Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
4C-seq assays were performed according to Splinter et al [72 (link)] with slight modifications. Briefly, 4 × 107 cells were crosslinked with 1% formaldehyde. The nuclei pellets were isolated by cell lysis with cold lysis buffer (10 mM Tris-HCl, 10 mM NaCl, 5 mM EDTA, 0.5% NP 40) supplemented with protease inhibitors (Roche). First step digestion was performed overnight at 37 °C with HindIII enzyme (NEB). Digestion efficiency was measured by RT-qPCR with HindIII site-specific primers. After confirmation of good digestion efficiency, DNA was ligated overnight at 16 °C by T4 DNA ligase (Thermo Scientific) and de-crosslinked. Following de-crosslinking, DNA was extracted by phenol-chloroform and this is the 3C library. The DNA was then processed for second digestion with DpnII enzyme (NEB) overnight at 37 °C. After final ligation, 4C template DNA was obtained, and the concentration was determined using Qubit assays (Thermo Scientific). The 4C template DNA was then amplified using specific primers with Illumina Nextera adapters and sent for sequencing on the MiSeq system. All the 4C genome coordinates are listed in Additional file 1 : Table S9.
5
Hi-C Library Generation Optimized
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hi-C libraries were processed as described in the previously published in situ protocol and with minor modification using our in-house modified version17 (link). Briefly, ~1 million cells were fixed in 2% formaldehyde, lysed, and digested overnight with DpnII enzyme (New England BioLabs, M0202). PCR amplification (4–8 cycles) using the NEBNext Ultra II Q5 Master Mix (New England BioLabs, M0544). PCR purification and size selection were carried out using Agencourt AMPure XP beads (Beckman Coulter, A63881). Libraries were deep sequenced (~360 million fragments) in 75 bp, or 100 bp paired-end runs on a NovaSeq6000 (Illumina). For each individual, the Hi-C library was created by pooling between two and four technical replicates generated from two different cell cultures, to ensure higher complexity of the sequencing library.
6
Hi-C Sequencing of Plant Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fourteen-day-old shoots or roots were used for in situ Hi-C. The experiment was carried out according to the protocol published by Liu et al. [74 (link)] using DpnII enzyme (New England Biolabs) with minor modifications concerning library preparation for which we used NEBNext UltraII DNA library preparation kit (New England Biolabs). For library amplification, nine PCR cycles were performed and Hi-C libraries were purified with SPRI magnetic beads (Beckman Coulter) and eluted in 20 µl of nuclease-free water. The quality of the libraries was assessed with Agilent 2100 Bioanalyzer (Agilent), and the libraries were subjected to 2 × 100 bp paired-end high-throughput sequencing by HiSeq 4000 (Illumina).
7
In situ Hi-C protocol for chromatin conformation
Check if the same lab product or an alternative is used in the 5 most similar protocols
In situ high-throughput chromatin conformation capture (Hi-C) was generated according previous described with some modifications.11 (link) Briefly, muscle tissue was homogenized and fixed with freshly made 1% formaldehyde solution at room temperature for 30 min. Chromatin were digested with 200 U DpnII enzyme (R0543S, NEB, USA) at 37°C for 90 min, 65°C for 20 min and 25°C for 5 min. Nucleotide fill-in with 0.4 mM Biotin-14-dATP (19524-016, Invitrogen), 10 mM dCTP, 10 mM dGTP, 10 mM dTTP and 5 U/μL Klenow Fragment (M0210L, NEB) at 37°C for 45 min. Ligation was performed by a T4 DNA ligase (L6030-HC-L, Enzymatics, USA) at 20°C for 30 min. DNA was sheared to the length of 300–400 bp and washed by M280 beads at 20°C for 20 min. Hi-C libraries were amplified 10 PCR amplification cycles using mixed universal PCR primer and index primer. The resulting libraries were sequenced on BGISEQ-500 as 100 bp paired-end.
+ Expand
In situ high-throughput chromatin conformation capture (Hi-C) was generated according previous described with some modifications.11 (link) Briefly, muscle tissue was homogenized and fixed with freshly made 1% formaldehyde solution at room temperature for 30 min. Chromatin were digested with 200 U DpnII enzyme (R0543S, NEB, USA) at 37°C for 90 min, 65°C for 20 min and 25°C for 5 min. Nucleotide fill-in with 0.4 mM Biotin-14-dATP (19524-016, Invitrogen), 10 mM dCTP, 10 mM dGTP, 10 mM dTTP and 5 U/μL Klenow Fragment (M0210L, NEB) at 37°C for 45 min. Ligation was performed by a T4 DNA ligase (L6030-HC-L, Enzymatics, USA) at 20°C for 30 min. DNA was sheared to the length of 300–400 bp and washed by M280 beads at 20°C for 20 min. Hi-C libraries were amplified 10 PCR amplification cycles using mixed universal PCR primer and index primer. The resulting libraries were sequenced on BGISEQ-500 as 100 bp paired-end.
8
Chromatin Interaction Profiling in Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One gram of 14-day-old shoots was cross-linked in 1% (v/v) formaldehyde at room temperature for 20 min. Cross-linked plant material was ground, and the nuclei were isolated and treated with SDS 0.5% at 62 °C for 5 min. SDS was sequestered with 2% Triton X-100. Digestions were performed overnight at 37 °C using 150 U of DpnII enzyme (New England Biolabs). Restriction enzymes were inactivated by the addition of 1.6% SDS and incubation at 62 °C for 20 min. SDS was sequestered with 1% Triton X-100. DNA was ligated by incubation at 22 °C for 5 h using 4000 U of T4 DNA ligase (Fermentas). Reverse crosslinking was performed by overnight treatment at 65 °C. DNA was recovered after Proteinase K treatment by phenol/chloroform extraction and ethanol precipitation. Relative interaction frequencies were calculated by quantitative real-time PCR using 15 ng of DNA. A region uncut by DpnII was used to normalize the amount of DNA.
| Primer list for 3Cassays | |
|---|---|
| Primer name | Sequence |
| TraesCS1B02G226200 | AAATTGGCTGCCGATTGGTTCG |
| TraesCS1B02G226300 | CTGGGCTAAAAGCCTCACACGTT |
| TraesCS4D02G254100 | TGGCGATAATGCAACATTGCAGAA |
| TraesCS4D02G254200 | ATTTACCTGCAAGGAGAGTTCCCC |
| TraesCS7A02G231500 | AAACAAGCTCTTGAGGTGACATCG |
| TraesCS7A02G231600 | CCCAGTTGGTTATTCGGCAGT |
| TraesCS1D02G176100 | GACTAGCACCCCCAAGCATTCC |
| TraesCS1D02G176200 | AGCTTGGATGCCTGCTTACGG |
9
4C-seq Assays with Modifications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
4C-seq assays were performed according to Splinter et al.67 (link) with slight modifications. Briefly, 4 × 107 cells were cross-linked with 1% formaldehyde. The nuclei pellets were isolated by cell lysis with cold lysis buffer (10 mM Tris-HCl, 10 mM NaCl, 5 mM EDTA, 0.5% NP 40) supplemented with protease inhibitors (Roche). First step digestion was performed overnight at 37 °C with HindIII enzyme (NEB). Digestion efficiency was measured by RT-qPCR with HindIII site-specific primers. After confirmation of good digestion efficiency, DNA was ligated overnight at 16 °C by T4 DNA ligase (Thermo Scientific) and de-crosslinked. Following de-crosslinking, DNA was extracted by phenol-chloroform and this is the 3C library. The DNA was then processed for second digestion with DpnII enzyme (NEB) overnight at 37 °C. After final ligation, 4C template DNA was obtained, and the concentration was determined using Qubit assays (Thermo Scientific). The 4C template DNA was then amplified using specific primers with Illumina Nextera adapters and sent for sequencing on the MiSeq system. All the 4C genome coordinates are listed in Supplementary Table 4 .
10
Chromatin Interaction Profiling in Tomato
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Four-week-old tomato fourth leaves were cross-linked in 1% (v/v) formaldehyde at room temperature for 20 min. Cross-linked plant material was ground and nuclei were isolated and treated with 0.5% SDS at 62 °C for 5 min. The SDS was then supplemented with 2% Triton X-100. Digestions were performed overnight at 37 °C using 150U of DpnII enzyme (New England Biolabs). Restriction enzymes were inactivated by adding 1.6% SDS and incubated at 62 °C for 20 min. SDS was supplemented with 1% Triton X-100. DNA was ligated by incubating at 22 °C for 5 h using 4000U of T4 DNA ligase (Fermentas). Reverse crosslinking was performed by overnight treatment at 65 °C. DNA was recovered after Proteinase K treatment by phenol-chloroform extraction and ethanol precipitation. Relative interaction frequencies were calculated by quantitative PCR using 15 ng of DNA. A region uncut by DpnII was used to normalize the amount of DNA. Details for primers used for 3C-qPCR are listed in Supplementary Data 3 . Two independent biological replicates were generated.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!