4nrUAS-tagRFPCaax-pA-4nrUAS-eGFP-Rab5c-pA;cmcl2:eGFP;-Rab7-pA;cmcl2:eGFP;-Rab11a-pA;cmcl2:eGFPFusion proteins were generated by fusing rab5c, and rab7 open reading frames from p3’E vectors (kindly provided by Brian Link [42 (link)]) with eGFP into pME (Tol2Kit) [43 (link)]. UAS constructs were assembled by combining pME-rab-GFP, p3’E-SV40 and a p5′E-4nrUAS-tagRFPCaax-pA-4nrUAS vector (containing a membrane-bound tagRFP reporter under the expression of four non-repeated UAS sequences) [44 (link)] into a pDestTol2CG #393 destination vector [43 (link)] using the MultiSite Gateway Three-Fragment Vector Construction Kit (ThermoFisher Scientific). The rab11a cDNA was amplified from zebrafish total cDNA using primers 5’E- atggggacacgagacgacg and 5′- ctagatgctctggcagcactg and cloned into a pDONRP2R-P3 to generate a p3’E vector, which was combined with a pME-eGFP vector and a p5’-4nrUAS-tagRFPCaax-pA-4nrUAS vector into a pDestTol2CG #393 destination vector [43 (link)] using the MultiSite Gateway Three-Fragment Vector Construction Kit (ThermoFisher Scientific).
Multisite gateway three fragment vector construction kit
The MultiSite Gateway Three-Fragment Vector Construction Kit is a tool for cloning multiple DNA fragments into a vector using the Gateway Cloning Technology. The kit includes the necessary components to assemble three DNA fragments into a single expression vector.
Lab products found in correlation
25 protocols using multisite gateway three fragment vector construction kit
Generating Rab Fusion Proteins in Zebrafish
4nrUAS-tagRFPCaax-pA-4nrUAS-eGFP-Rab5c-pA;cmcl2:eGFP;-Rab7-pA;cmcl2:eGFP;-Rab11a-pA;cmcl2:eGFPFusion proteins were generated by fusing rab5c, and rab7 open reading frames from p3’E vectors (kindly provided by Brian Link [42 (link)]) with eGFP into pME (Tol2Kit) [43 (link)]. UAS constructs were assembled by combining pME-rab-GFP, p3’E-SV40 and a p5′E-4nrUAS-tagRFPCaax-pA-4nrUAS vector (containing a membrane-bound tagRFP reporter under the expression of four non-repeated UAS sequences) [44 (link)] into a pDestTol2CG #393 destination vector [43 (link)] using the MultiSite Gateway Three-Fragment Vector Construction Kit (ThermoFisher Scientific). The rab11a cDNA was amplified from zebrafish total cDNA using primers 5’E- atggggacacgagacgacg and 5′- ctagatgctctggcagcactg and cloned into a pDONRP2R-P3 to generate a p3’E vector, which was combined with a pME-eGFP vector and a p5’-4nrUAS-tagRFPCaax-pA-4nrUAS vector into a pDestTol2CG #393 destination vector [43 (link)] using the MultiSite Gateway Three-Fragment Vector Construction Kit (ThermoFisher Scientific).
Constructing pUAS-EB3-GFP Plasmid
Generating mnx1:lyn-eGFP-pA Construct
Generation of dendra2-rab3 Expression Construct
Integrated C. elegans Transgene Construction
Set-2 transcriptional reporter cloning
Transgenic Construct Assembly for vha-13::GFP
Multisite Gateway Cloning for C. elegans
Generating Fluorescent Fusion Constructs
Deletion of hcpA gene in P. chrysogenum
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!