To evaluate the efficiency of siRNA knockdown in HeLa cells, we performed real-time PCR analyses. HeLa cells were transfected with the indicated siRNA or scrRNA control. cDNA was obtained using a Cells-to-cDNA kit (Ambion). Genomic DNA was removed using a DNA removal kit (Ambion). cDNA was obtained using the oligo dT primer. Real-time PCR was performed using a Fast SYBR Green master mix (Applied Biosystems). Primer sequences for the expression analysis were as follows: KCNA1, TTCTTCGACCGCAACCGGCC and AGCTATCTCGGTGCCCAGGGT; RPL14, AGGTTGGCCGGGTGGCCTAT and AGGCGCTGCTTTCTGGCCTG; SBP2, GCAGGCAGAGCTGTCAGGGC and TGGGCTCTCCCACCAGCTCC. Special 18S rRNA modified primers (Ambion) were used as an internal control for data normalization. We also compared the consequence of downregulation with the individual and pooled DNAJC17 siRNAs, since knockdown of this gene showed the strongest effect on ATP7A levels. These studies revealed that only one individual siRNA (#2) decreased the ATP7A levels similarly to the pool, whereas other individual siRNA (and a combination of three out of four, #1, #3 and #4) had no significant effect on ATP7A levels despite a significant decrease in the mRNA levels for DNAJC17 (confirmed by real-time PCR). Thus, the effect of DNAJC17 knockdown on ATP7A may be indirect or confounded by other unknown factors.
Special 18s rrna modified primers
Manufactured by Thermo Fisher Scientific
The Special 18S rRNA modified primers are a set of oligonucleotide sequences designed to target and amplify the 18S ribosomal RNA (rRNA) gene. These primers are modified to enhance specificity and efficiency in the detection and quantification of 18S rRNA in various biological samples.
Automatically generated - may contain errors
2 protocols using special 18s rrna modified primers
1
Evaluating siRNA Knockdown Efficiency in HeLa Cells
2
Evaluating siRNA Knockdown Efficiency in HeLa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To evaluate the efficiency of siRNA knockdown in HeLa cells, we performed real-time PCR analyses. HeLa cells were transfected with the indicated siRNA or scrRNA control. cDNA was obtained using a Cells-to-cDNA kit (Ambion). Genomic DNA was removed using a DNA removal kit (Ambion). cDNA was obtained using the oligo dT primer. Real-time PCR was performed using a Fast SYBR Green master mix (Applied Biosystems). Primer sequences for the expression analysis were as follows: KCNA1, TTCTTCGACCGCAACCGGCC and AGCTATCTCGGTGCCCAGGGT; RPL14, AGGTTGGCCGGGTGGCCTAT and AGGCGCTGCTTTCTGGCCTG; SBP2, GCAGGCAGAGCTGTCAGGGC and TGGGCTCTCCCACCAGCTCC. Special 18S rRNA modified primers (Ambion) were used as an internal control for data normalization. We also compared the consequence of downregulation with the individual and pooled DNAJC17 siRNAs, since knockdown of this gene showed the strongest effect on ATP7A levels. These studies revealed that only one individual siRNA (#2) decreased the ATP7A levels similarly to the pool, whereas other individual siRNA (and a combination of three out of four, #1, #3 and #4) had no significant effect on ATP7A levels despite a significant decrease in the mRNA levels for DNAJC17 (confirmed by real-time PCR). Thus, the effect of DNAJC17 knockdown on ATP7A may be indirect or confounded by other unknown factors.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!