The expression levels of iNOS mRNA in ACs and total BAL cells were determined by quantitative real‐time PCR (qRT‐PCR) as described previously.12 First‐strand cDNA was synthesized by PrimeScript RT Reagent Kit (Takara Bio, Shiga, Japan) with both oligo(dT) primer and random hexamers. Reverse transcription was performed with a TaKaRa PCR Thermal Cycler MP (TP3000, Takara Bio). The following sequences were used for iNOS and GAPDH. iNOS: forward primer, 5′‐GCACGGCAACACATTGAA‐3′; reverse primer, 5′‐TGAGGTTCTGAAGGCCTAAATC‐3′; GAPDH: forward primer, 5′‐GCACCGTCAAGGCTGAGAAC‐3′; reverse primer, 5′‐TGGTGAAGACGCCAGTGGA‐3′.
Diluted first‐strand cDNA product (4 μL) was used for amplification in a 25‐μL reaction solution containing 12.5 μL SYBR Premix Ex Taq II (Takara Bio) and 1 μL of each primer. DNA was amplified for 40 cycles of denaturation at 95°C for 5 seconds and annealed at 60°C for 30 seconds with the Takara Thermal Cycler Dice (TP900; Takara Bio). The data generated from each PCR reaction were analysed using Thermal Cycler Dice Real Time System version 4.2 (Takara Bio). The specificity of the reactions was determined by melting curve analysis. The relative expression of each gene of interest and GAPDH were calculated by the ΔΔCt method.
Diluted first‐strand cDNA product (4 μL) was used for amplification in a 25‐μL reaction solution containing 12.5 μL SYBR Premix Ex Taq II (Takara Bio) and 1 μL of each primer. DNA was amplified for 40 cycles of denaturation at 95°C for 5 seconds and annealed at 60°C for 30 seconds with the Takara Thermal Cycler Dice (TP900; Takara Bio). The data generated from each PCR reaction were analysed using Thermal Cycler Dice Real Time System version 4.2 (Takara Bio). The specificity of the reactions was determined by melting curve analysis. The relative expression of each gene of interest and GAPDH were calculated by the ΔΔCt method.