Blood rna kit
The Blood RNA Kit is a laboratory tool designed to extract and purify RNA from whole blood samples. It utilizes a silica-based membrane technology to isolate high-quality RNA for downstream applications.
3 protocols using blood rna kit
Comprehensive RNA Extraction and Analysis
Caspase-3 Expression via RT-PCR
Quantifying HPSE2 Expression Using qRT-PCR
The primers were as follows: GAPDH-Forward: GGTGAAGGTCGGAGTCAACG,
GAPDH-Reverse: TGGGTGGAATCATATTGGAACA,
HPSE2-Forward: ATGGCCGGGCAGTAAATGG,
HPSE2-Reverse: GCTGGCTCTGGAATAAATCCG.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!