Blood rna kit

Tissue and blood RNA were extracted using the Tissue RNA Kit (OMEGA Bio-tek, R6688-01, USA) and the Blood RNA Kit (OMEGA bio-tek, R6814-01C, USA) according to the manufacturers’ instructions. TRIzol reagent (Invitrogen) was utilized to extract RNA from cultured cells according to the manufacturer’s instructions. A ratio of (A260)/(A280) is an indication of nucleic acid purity. A value greater than 1.8 indicated > 90% nucleic acid purity. For reverse transcription, 1 μg RNAs were inversely transcribed into 20 μL cDNA with a reverse transcription kit (Takara, Dalian, China). The relative expression of LEMD1 was determined in three independent experiments and normalized using the 2^−ΔΔCt method relative to GAPDH. The primers used in this experiment are shown in DATA S1.

Tissue and blood RNA were extracted according to the instruction of Tissue RNA Kit (OMEGA bio-tek, R6688-01, USA) and Blood RNA Kit (OMEGA bio-tek, R6814-01C, USA). TRIzol reagent (Invitrogen) was utilized to extract RNAs from cultured cells according to manufacturer’s instructions. A ratio of (A260)/(A280) is an indication of nucleic acid purity. A value greater than 1.8 indicates > 90% nucleic acid purity. For qRT-PCR, 1 μg RNAs were inversely transcribed into 20 μl cDNA with a Reverse Transcription Kit (Takara, Dalian, China). qRT-PCR was analyzed according to our previously published article [12 (link)]. The relative expression of HPSE2 was performed for three independent times and normalized using the 2^{− ΔΔCt} method relative to GAPDH.
The primers were as follows: GAPDH-Forward: GGTGAAGGTCGGAGTCAACG,
GAPDH-Reverse: TGGGTGGAATCATATTGGAACA,
HPSE2-Forward: ATGGCCGGGCAGTAAATGG,
HPSE2-Reverse: GCTGGCTCTGGAATAAATCCG.