E z n a soil kit

Total DNA was extracted under the instructions of the EZNA® Soil Kit (Omega Bio-Tek, Norcross, GA, US). DNA purity and concentration were assessed by a NanoDrop2000, and the quality of the extracted DNA was examined using DNA electrophoresis. Using the primers 806R (5′-GGACTACHVGGGTWTCTAAT-3′) and 338F (5′-ACTCCTACGGGAGGCAGCAG-3′), the polymerase chain reaction amplification of the V3-V4 variable region was performed using an ABI GeneAmp® 9700 and the program 95°C predenaturation for 180s was carried out, and then 27 cycles of 95°C denaturation for 30 s, annealing for 30s at 55°C, and extension for 30s at 72°C, with an extension for 600s at 72°C were carried out. Followed by the 20-µl volume amplification system includes 10 ng DNA template, 2 µl 2.5 mM dNTPs, 4 µl of 5x FastPfu buffer, 0.4 µl FastPfu polymerase, and 0.8 µl primer (5 µM).

DNA was extracted from wetland flat soil samples using the E.Z.N.A soil kit (Omega Bio-tek, Norcross, GA, USA). Three copies of each sample were extracted, and the resulting DNA was mixed. DNA concentration and purity were measured by NanoDrop2000, and quality of extracted DNA was measured using 1% agarose gel electrophoresis. The V3-V4 region of bacterial DNA was amplified via a polymerase chain reaction (PCR) using 338FmodF (5′-ACTCCTACGGGAGGCAGCAG-3′) and 806RmodR (5′-GGACTACHVGGGTWTCTAAT-3′) primers [18 (link)]. The two primers have increased the coverage of sequences available in the Ribosomal Database Project (RDP) and have been widely and successfully used in many previous studies for Illumina-based surveys of bacteria [19 (link)]. Detection results of PCR products from all samples were collected in a set for paired-end sequencing.

The experiments included extracting the total DNA from samples (n = 6 per group) of the faces. The data were analyzed on the free online Majorbio I-Sanger Cloud Platform. Total DNA was extracted according to the instructions of the E.Z.N.A.® SOIL Kit (Omega Bio-Tek, Norcross, GA, U.S.). The concentration and purity of DNA were measured using a NanoDrop 2000 spectrophotometer, and the quality of the DNA extraction was confirmed by 1% agarose gel electrophoresis. PCR amplification of the V3–V4 variable region was performed using 338F (5′-ACT CCT ACG GGA GCA GCA G-3′) and 806R (5′-GGA CTA CHVGGG TWT CTAAT-3′) primers (Liu et al., 2016 (link)). The microbial composition was analyzed via 16S rRNA sequencing by Shanghai Majorbio Bio-pharm Technology (Shanghai, China) according to standard instructions.

Fecal DNA was extracted from cecum stool samples using E.Z.N.A. soil kit (Omega Bio-Tek, GA, USA) following the manufacturer's instructions. The hypervariable V3-V4 region of the 16S-rDNA gene was amplified by PCR using the primers 338F: 5′-ACTCCTACGGGAGGCAGCAG-3′. The cycling conditions were as follows: initial denaturation at 95°C for 3 min, 28 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, elongation at 72°C for 45 s, and final extension at 72°C for 5 min and 10°C until completion. Amplicons were recovered from 2% agarose gels and purified using an AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, CA, USA) following the manufacturer's instructions and quantified using a QuantiFluor-ST fluorometer (Promega, USA). The purified amplicons were pooled in equimolar ratio and paired-end sequenced (2 × 300 bp) using PE300 strategies on an Illumina MiSeq platform (Illumina, CA, USA). The raw reads were deposited into the NCBI Sequence Read Archive database (accession number: SRP168312).

Sequencing services were provided by Wekemo Tech Group Co., Ltd., Shenzhen China., using the E.Z.N.A.® soil kit (Omega Bio‐Tek, Norcross, GA, U.S.) to extract microbial DNA from the samples, using the NanoDrop 2000 kit to check DNA concentration and purity, and then using 1% agarose gel electrophoresis to check DNA extraction quality. Bacteria were amplified by PCR using primers 338 F (5′‐ACTCCTACGGGAGGCAGCAG‐3′) and 806 R (5′‐GGACTACHVGGGTWTCTAAT‐3′) targeting the V3‐V4 variable region of the 16 S ribosomal RNA (rRNA) gene (Wang et al., 2019 (link)). The fungi were amplified using ITS1‐1F‐F (5′‐CTTGGTCATTAGAGGAGTAA‐3′) and ITS‐1F‐R (5′‐GCTGCGTT CTTCATCGATGC‐3′) primers targeting the ITS1‐1F region of the ITS rDNA gene in the ribosome (Manter & Vivanco, 2007 (link); Maryam et al., 2015 ; White et al., 1990 (link)).

Fecal samples were collected by germ-free disposable sampling spoon and frozen immediately at − 80 °C. Fecal microbial DNA was extracted from 180–220 mg feces using E.Z.N.A.^® soil Kit (Omega Bio-tek, Norcross, GA, USA) according to manufacturer’s protocols. The DNA concentration and purification were determined by NanoDrop 2000 UV–Vis spectrophotometer (Thermo Scientific, Wilmington, USA), and DNA quality was checked by 1% agarose gel electrophoresis. The qualified fecal bacterial genomic DNA samples were stored in Tris–HCl buffer, pH 8.0, at − 20 °C.