Rnalater reagent

Manufactured by Merck Group

Sourced in United States

RNAlater is a stabilization reagent designed to preserve the integrity of RNA in biological samples. It prevents the degradation of RNA molecules by inhibiting the activity of RNase enzymes. RNAlater can be used to store samples at ambient temperature, eliminating the need for immediate freezing or processing, making it a convenient option for research applications.

Automatically generated - may contain errors

Lab products found in correlation

Rneasy mini kit, by Qiagen (2 mentions) Kanamycin, by Merck Group (2 mentions) Lightcycler 480, by Roche (2 mentions) Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions) Turbo dnase kit, by Thermo Fisher Scientific (1 mentions) Hiseq instrument, by Illumina (1 mentions) Rnalater reagent, by Thermo Fisher Scientific (1 mentions) Pellet pestle motor, by Merck Group (1 mentions) Ecodry premix, by Takara Bio (1 mentions) Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions) Power sybr green master mix, by Thermo Fisher Scientific (1 mentions) Superscript 3 first strand synthesis kit, by Thermo Fisher Scientific (1 mentions) Iscript cdna synthesis kit, by Bio-Rad (1 mentions) Precellys 24 tissue homogenizer, by Bertin Technologies (1 mentions) Lightcycler 480 sybr green 1 master, by Roche (1 mentions) 0.22 μm membrane, by Merck Group (1 mentions) Amicon ultra filter, by Merck Group (1 mentions) Rneasy plus mini kit, by Qiagen (1 mentions) Lightcycler 480 probes master, by Roche (1 mentions) Penicillin streptomycin, by Corning (1 mentions)

14 protocols using rnalater reagent

Zebrafish 25hpf RNA-Seq Transcriptomics

Check if the same lab product or an alternative is used in the 5 most similar protocols

For each biological replicate (n = 7) experimental embryos (MCT8 MO and CTR MO embryos) at 25hpf were dechorinated, and pooled (~50 embryos per replicate) and preserved in RNAlater reagent (Sigma-Aldrich) and stored at -20 °C until use.
Collected embryos were removed from RNAlater reagent and homogenised with a glass homogeniser and RNA extracted using an OMEGA Total RNA extraction kit I as described by the manufacturer. Total RNA was subjected to DNAse treatment using an Ambion Turbo DNAse kit as described by the manufacturer. The quality (RIN > 8) and quantity of total RNA was verified with a BIO-RAD Experion Total RNA chip following the manufacturer’s instructions. Ten micrograms of total RNA per sample was shipped on dry-ice to the Oklahoma Medical Research Foundation NGS core facility for Illumina RNA-seq sequencing (USA). One microgram of total RNA per sample was amplified using a TrueSeq stranded pair-end Illumina kit following the standard protocol. Sequencing of mRNA was conducted on an Illumina HiSeq instrument and 50 base paired end reads generated. cDNA libraries from each of the 14 biological samples (n = 7 controls and n = 7 MCT8 MO zebrafish 25hpf) was randomized and then sequenced in two lanes of the HiSeq instrument, following an experimental balanced block design.

Silva N., Louro B., Trindade M., Power D.M, & Campinho M.A. (2017). Transcriptomics reveal an integrative role for maternal thyroid hormones during zebrafish embryogenesis. Scientific Reports, 7, 16657.

+ Open protocol

+ Expand

Quantifying Transcriptional Regulators in Murine Discs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

NP tissue was dissected from lumbar and caudal discs of 5-and 18-month C57BL/6 mice, and immediately placed in RNAlater® Reagent (INVITROGEN). 7 mice per genotype were sacrificed for RNA isolation and NP tissue pooled from single animal served as an individual sample. NP tissue was collected in RNAlater® Reagent and homogenized with a Pellet Pestle Motor (Sigma Aldrich, Z359971). Total RNA was extracted from the tissue lysates using RNeasy® Mini kit (Qiagen). The purified, DNA-free RNA was converted to cDNA using EcoDry™ Premix (Clontech). Template cDNA and gene-specific primers were added to Power SYBR Green master mix (Applied Biosystems) and mRNA expression was quantified using the Step One Plus Real-time PCR System (Applied Biosystems). GAPDH was used to normalize gene expression. Melting curves were analyzed to verify the specificity of the RT-PCR and the absence of primer dimer formation. Thermal cycle was programmed for 20 s at 95 °C as initial denaturation, followed by 40 cycles of 30 s at 95 °C, and 30 s at 60 °C, with final melt curve and extension for 15 s at 95 °C, 1 min. at 60 °C, and 15 s at 95°C. Custom PCR primers specific to murine p53 (F: TAGGTAGCGACTACAGTTAGGG; R: CATGGCAGTCATCCAGTCTT), p19^Arf (F: TGAGGCTAGAGAGGATCTTGAGAA; R: GTGAACGTTGCCCATCATCATC); and p16^Ink4a (F: CGGTCGTACCCCGATTCAG; R: GCACCGTAGTTGAGCAGAAGAG) were reported earlier[27 (link)].

Novais E.J., Diekman B.O., Shapiro I.M, & Risbud M.V. (2019). p16Ink4a deletion in cells of the intervertebral disc affects their matrix homeostasis and senescence associated secretory phenotype without altering onset of senescence. Matrix biology : journal of the International Society for Matrix Biology, 82, 54-70.

+ Open protocol

+ Expand

Transcriptional Profiling of Larval Neurons

Check if the same lab product or an alternative is used in the 5 most similar protocols

Wandering third instar larvae were collected from wild type, dnrx, dnlg1 and wit mutants and washed twice and dissected in 1XPBS. Larval musculature and brain lobes/VNC were isolated, separated and transferred to RNA Later™ reagent (Sigma-Aldrich, St. Louis, MO) on ice. RNA was extracted using the QIAGEN RNAeasy kit (Thermo Fisher, Waltham, MA). cDNA was synthesized using Superscript III first strand synthesis kit (Thermo Fisher, Waltham, MA) with random oligoDT primers and used for qRTPCR analysis. qRTPCR assay was performed using the following taqman primers for the indicated genes.

Banerjee S., Venkatesan A, & Bhat M.A. (2016). Neurexin, Neuroligin and Wishful Thinking Coordinate Synaptic Cytoarchitecture and Growth at Neuromuscular Junctions. Molecular and cellular neurosciences, 78, 9-24.

+ Open protocol

+ Expand

Cultivation of A. baumannii and E. coli

Check if the same lab product or an alternative is used in the 5 most similar protocols

A. baumannii ATCC 17978 was routinely grown in Mueller-Hinton (MH) or Luria-Bertani (LB) broth or agar. Escherichia coli TG1 was grown in LB broth and used for cloning procedures. E. coli OP50 (Caenorhabditis Genetics Center) was grown in LB and used for Caenorhabditis briggsae virulence assays. All strains were grown at 37°C and stored at -80°C in LB containing 10% glycerol. The concentration of antibiotic used for selection of transformants was 50 μg/mL of kanamycin (Sigma-Aldrich, St. Louis, MO). For obtaining planktonic cells, a single colony of A. baumannii ATCC 17978 was isolated on LB agar and grown in 5 mL of LB broth overnight at 37°C in an orbital shaker at 180 rpm. The resulting culture was diluted 100-fold in 500 mL of LB broth in 1L-flasks and incubated under the same conditions. Optical density (OD) was evaluated at 600 nm each 30 min. Cells were harvested at exponential (OD_600nm = 0.4) and late stationary (OD_600nm = 2.0) phases of growth after inoculation. Finally, exponential and stationary cells were resuspended in RNA later reagent (Sigma-Aldrich, St. Louis, MO), frozen using liquid nitrogen and stored at -80°C until RNA extraction.

Álvarez-Fraga L., Rumbo-Feal S., Pérez A., Gómez M.J., Gayoso C., Vallejo J.A., Ohneck E.J., Valle J., Actis L.A., Beceiro A., Bou G, & Poza M. (2017). Global assessment of small RNAs reveals a non-coding transcript involved in biofilm formation and attachment in Acinetobacter baumannii ATCC 17978. PLoS ONE, 12(8), e0182084.

+ Open protocol

+ Expand

Acinetobacter baumannii Biofilm Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

A total of 172 strains collected during the 2nd Spanish study of colonizations/infections caused by A. baumannii (GEIH/REIPI-Ab2010)⁴¹ (link) were used for phenotypic analysis, being 25 representative strains further selected for biofilm formation assays. One of them was Acinetobacter baumannii strain MAR002, isolated from a wound sample collected from a patient in the Hospital del Mar (Barcelona, Spain). A. baumannii and Escherichia coli strains were routinely grown in Luria-Bertani (LB) broth. Agar at 2% was added when necessary. All strains were grown at 37°C with shaking (180 rpm), and stored at −80°C in LB broth containing 10 % glycerol. The concentration of kanamycin (Sigma-Aldrich) used for selection of transformant strains was 50 μg/mL. Swimming broth medium (SB), containing 10 g tryptone/L and 5 g NaCl/L, was used for biofilm analysis. For obtaining planktonic cells, a single colony of both A. baumannii MAR002 and ATCC 17978 strains was taken from LB agar plates and grown in 5 mL of LB broth overnight. One mL of the resulting culture was used to inoculate 100 mL of LB broth. Optical density (OD_600nm) was evaluated each 30 min to determine bacterial growth. Cells were harvested during the exponential phase (OD_600nm = 0.6) and resuspended in RNA later reagent (Sigma-Aldrich), frozen using liquid nitrogen and stored at −80°C.

Álvarez-Fraga L., Pérez A., Rumbo-Feal S., Merino M., Vallejo J.A., Ohneck E.J., Edelmann R.E., Beceiro A., Vázquez-Ucha J.C., Valle J., Actis L.A., Bou G, & Poza M. (2016). Analysis of the role of the LH92_11085 gene of a biofilm hyper-producing Acinetobacter baumannii strain on biofilm formation and attachment to eukaryotic cells. Virulence, 7(4), 443-455.

+ Open protocol

+ Expand

Gene Expression Profiling of Jejunal Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

Jejunal tissues were stored in RNA-later reagent (Sigma-Aldrich, USA) overnight at 4°C and kept at −80°C until processed. Tissue samples were homogenized by Precellys 24 tissue homogenizer (Bertin Technologies, FR) at 5,000 rpm for 20 s using tubes with zirconium oxide beads. RNA was isolated via RNeasy Mini kit (Qiagen, Valencia, CA). An iScript cDNA Synthesis Kit (BioRad Laboratories, USA) was used to generate cDNA. Real-Time (RT) PCR was performed on the LightCycler® 480 instrument (Roche, DE) using LightCycler® 480 SYBR Green I Master according to the manufacturer's instructions (Roche, DE). β-actin was used as an internal control to normalize gene expression using the 2–ΔCt method (38 (link)). RT PCR primer sequences are listed in Supplementary Table 1.

Schwarzer M., Hermanova P., Srutkova D., Golias J., Hudcovic T., Zwicker C., Sinkora M., Akgün J., Wiedermann U., Tuckova L., Kozakova H, & Schabussova I. (2019). Germ-Free Mice Exhibit Mast Cells With Impaired Functionality and Gut Homing and Do Not Develop Food Allergy. Frontiers in Immunology, 10, 205.

+ Open protocol

+ Expand

Wastewater Sample Processing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Samples of 100 mL were processed immediately after collection at 4 °C. Firstly, 100 mL samples were centrifuged for 30 min at 4000 ×g and then filtered through 0.22 μm membranes (Merck Millipore). Regenerated cellulose Amicon Ultra Filters of 30 kDa (Merck Millipore) were used to concentrate and dialyze, keeping the fraction retained, in 500 μL of a buffer containing 50 mM Tris-HCL, 100 mM NaCl and 8 mM MgSO₄. Samples were preserved in RNAlater reagent (Sigma-Aldrich) at −80 °C.Fig. 1

Map showing Galicia region in Spain, the metropolitan area of A Coruña including Oleiros, Cambre, Culleredo, Arteixo and A Coruña municipalities, and the Health Area of A Coruña-Cee, as well as the specific locations of the University Hospital of A Coruña (CHUAC) and WWTP Bens.

Fig. 1

Vallejo J.A., Trigo-Tasende N., Rumbo-Feal S., Conde-Pérez K., López-Oriona Á., Barbeito I., Vaamonde M., Tarrío-Saavedra J., Reif R., Ladra S., Rodiño-Janeiro B.K., Nasser-Ali M., Cid Á., Veiga M., Acevedo A., Lamora C., Bou G., Cao R, & Poza M. (2021). Modeling the number of people infected with SARS-COV-2 from wastewater viral load in Northwest Spain. The Science of the Total Environment, 811, 152334.

+ Open protocol

+ Expand

Fish Sampling and Tissue Collection

Check if the same lab product or an alternative is used in the 5 most similar protocols

G. dobula and P. kaznakovi fish samples were captured from Yadong, the southeast of Qinghai-Tibet Plateau and Xialaxiu, Qinghai province, respectively. S. nukiangensis Tsao and S. gongshanensis fish samples were captured from the Nujiang river and Gongshan, Yunnan Province, respectively. S. prenanti samples were collected from Ya’an in Sichuan Province. Permissions for capturing the fishes were obtained from the local aquaculture administration bureau of Xizhang, Qinghai, Yunnan and Sichuan province, respectively. The locations of fish sampling are listed in Table 1. At each sampling site, environmental data including elevation, latitude and longitude were documented using a handheld GPS (Explorist 210, Magellan Corp, USA).
Fishes were live trapped and anaesthetized for the entire period of surgical procedures. The sampling were conducted according to the principles expressed in the “Guide for the Care and Use of Laboratory Animals” by National Research Council of the National Academies. The animal handling and care protocol used in this study was approved by the Ethics Committee for the Use of Animal Subjects of Shanghai Ocean University. Tissue samples were immediately infused in RNAlater reagent (Sigma-Aldrich, USA), transported to the laboratory and stored at −80 °C until RNA extraction.

Xu Q., Zhang C., Zhang D., Jiang H., Peng S., Liu Y., Zhao K., Wang C, & Chen L. (2016). Analysis of the erythropoietin of a Tibetan Plateau schizothoracine fish (Gymnocypris dobula) reveals enhanced cytoprotection function in hypoxic environments. BMC Evolutionary Biology, 16, 11.

+ Open protocol

+ Expand

Endometrial Deep-Infiltrating Lesion Sampling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Samples of endometrial deep-infiltrating lesions were excised by the bipolar cut (LAP BiSect, Erbe, Tübingen, Germany) during laparoscopy from uterosacral ligaments. Samples of eutopic endometrium were collected during surgery by trans-cervical endometrial aspiration biopsy (Pipelle, Cornier). Samples of tissue used for bulk tissue sequencing were preserves in RNA-later reagent (Sigma-Aldrich, St. Louis, MO, USA). Tissue samples prepared for laser-capture microdissection were rinsed in saline, immediately immersed in OCT medium (Optimal cutting temperature compound, Tissue-Tek, Torrance, CA, USA), and snap-frozen. Peripheral blood was collected to EDTA vials (BD Vacutainer, Franklin Lakes, NJ, USA) and immediately frozen. Tissue and blood samples were stored at −80 °C until further processing. Each patient provided a set of tree samples originating from blood, endometrium and deep nodule.

Koppolu A., Maksym R.B., Paskal W., Machnicki M., Rak B., Pępek M., Garbicz F., Pełka K., Kuśmierczyk Z., Jacko J., Rydzanicz M., Banach-Orłowska M., Stokłosa T., Płoski R., Malejczyk J, & Włodarski P.K. (2021). Epithelial Cells of Deep Infiltrating Endometriosis Harbor Mutations in Cancer Driver Genes. Cells, 10(4), 749.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Intestinal Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-rime ready Custom Panel 480–96+ PCR arrays were obtained (Roche) and quantitative PCR analysis performed. RNA was extracted from whole small intestinal tissue preserved in RNAlater reagent (Sigma), using RNeasy plus mini kits (Qiagen). Reverse transcription was performed, using Transcriptor First Strand cDNA Synthesis Kit followed by analysis of targets using LightCycler 480 Probes Master on a LightCycler 480 platform (all Roche). Standard protocols as per manufacturer recommendations were followed. CT values of target genes were normalized to expression of the housekeeping gene HPRT and fold change versus control samples calculated using the delta/delta CT method [25 (link)].

Hughes K.R., Harnisch L.C., Alcon-Giner C., Mitra S., Wright C.J., Ketskemety J., van Sinderen D., Watson A.J, & Hall L.J. (2017). Bifidobacterium breve reduces apoptotic epithelial cell shedding in an exopolysaccharide and MyD88-dependent manner. Open Biology, 7(1), 160155.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!