Uv transilluminator
A UV transilluminator is a laboratory instrument that uses ultraviolet (UV) light to visualize and analyze DNA or protein samples in gel electrophoresis. It emits UV light, typically in the wavelength range of 254-365 nm, which causes fluorescent molecules within the samples to emit visible light, allowing researchers to observe and document the results of their experiments.
Lab products found in correlation
30 protocols using uv transilluminator
Plasmid Extraction and Characterization
PCR Detection of Staphylococcus aureus
RT-PCR Detection of Virulent NDV
Details of oligonucleotide primers and probe used for partial amplification of NDV F gene in RRT-PCR and RT-PCR.
Primer | Sequence (5′–3′) | Product Size (bp) | Reference |
---|---|---|---|
F+4839 | TCCGGAGGATACAAGGGTCT | 101 | [25 (link)] |
F+4894 | [FAM]AAGCGTTTCTGTCTCCTTCCTCCA[TAMRA] | ||
F−4939 | AGCTGTTGCAACCCCAAG | ||
F 330 | AGGAAGGAGACAAAAACGTTTTATAGG | 370 | [24 (link)] |
R700 | TCAGCTGAGTTAATGCAGGGGAGG |
Multiplex PCR Assay for Virulence Genes
COI Gene Barcoding Protocol
Salmonella Identification by 16S rRNA PCR
Multiplex PCR for Campylobacter Detection
Agarose Gel Electrophoresis of PCR Products
Campylobacter species identification protocol
Molecular Identification of H. pylori Genotypes
Primer Sequences And Associated Amplification Conditions
Primer | Sequences | PCR Products | Amplification Conditions |
---|---|---|---|
glmM | AAGCTTTTAGGGGTGTTAGGGGTTT | 294 bp | 95 °C, 50 sec; 56 °C, 50 sec; 72 °C, 1 min (38 cycles) |
cagA | ATAATGCTAAATTAGACAACTTGAGCGA | 298 bp | 95 °C, 55 sec; 58 °C, 50 sec; 72 °C, 1 min (36 cycles) |
vacA s1/s2 | ATGGAAATACAACAAACACAC | 259/286 bp | 95 °C, 55 sec; 53 °C, 54 sec; 72 °C, 50 sec (37 cycles) |
vacA m1/m2 | CAATCTGTCCAATCAAGCGAG | 567/642 bp | 95 °C, 55 sec; 54 °C, 50 sec; 72 °C, 1 min (35 cycles) |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!