Real-time quantitative PCR (RT-qPCR) was performed using the EvaGreen Dye (Bio-Rad, United States) with the TransStart Tip Green qPCR supermix kit (TransGen Biotech, China). The cycle threshold (CT) value was recorded, and the relative quantification of gene expression was calculated using the 2–ΔΔCT method, with 16S rRNA as an internal control. The results were compared to gene expression in the D39Δspd0090 or D39Δspd0090+ with gene expression in the D39 strain. All data were obtained from three independent biological experiments. The primers used for RT-qPCR are shown in
Transstart tip green qpcr supermix kit
The TransStart Tip Green qPCR SuperMix kit is a reagent designed for real-time quantitative PCR (qPCR) analysis. It contains all the necessary components, including a proprietary DNA polymerase, buffer, dNTPs, and a green fluorescent dye, to amplify and detect target DNA sequences.
Lab products found in correlation
53 protocols using transstart tip green qpcr supermix kit
Transcriptomic Analysis of S. pneumoniae Strains
Real-time quantitative PCR (RT-qPCR) was performed using the EvaGreen Dye (Bio-Rad, United States) with the TransStart Tip Green qPCR supermix kit (TransGen Biotech, China). The cycle threshold (CT) value was recorded, and the relative quantification of gene expression was calculated using the 2–ΔΔCT method, with 16S rRNA as an internal control. The results were compared to gene expression in the D39Δspd0090 or D39Δspd0090+ with gene expression in the D39 strain. All data were obtained from three independent biological experiments. The primers used for RT-qPCR are shown in
Comprehensive RNA Extraction and qPCR Analysis
For the detection of miRNA expression, reverse transcription and qPCR were performed using stem-loop primers and Bulge-Loop™ miRNA RT-qPCR Starter Kit from Ribobio (Guangzhou, China). U6 snoRNA was used as the endogenous control. All experiments were performed in triplicate according to the manufacturer’s manual. Expression fold changes were calculated using 2-∆∆Ct methods.
RNA Extraction and RT-qPCR Analysis of Pneumococcal Mutant
Comparative Gene Expression Analysis of E. coli Strains
Transcriptional Analysis of Bacterial Gene Expression
RNA Extraction, cDNA Synthesis, and qRT-PCR Analysis
Quantification of Viral RNA in A549 Cells
Quantifying Gene Expression in M. javanica
Quantifying Gene Expression in Mouse Oocytes
Information of primers used in RT-qPCR
Genes | Accession ID | Primer Seq (5′→3′) | Product Length, bp | Tm, °C |
---|---|---|---|---|
Btg4 | NM_019493.4 | F: TGAACAACCCAAAGAGCGTCTACC | 103 | 55 |
R: AACCCACGACCATCTGCCAAATG | ||||
Orc2 | NM_001025378.2 | F: TGATTCATGTCTTACGAAGCCT | 107 | 55 |
R: AGAAAGTCCAATGTAGGAAGGG | ||||
Eif4e | NM_001313980.1 | F: ACTTTTGGGCTCTATACAACCA | 82 | 55 |
R: ATCCCGTCCTTAAAAAGTGAGT | ||||
Miss | NM_001045483.1 | F: GTCCTTTAGGTACACAGGGATC | 207 | 55 |
R: GATATGACGCTTCAGGAGTAGG | ||||
Doc1r | NM_026373.4 | F:ACGGACCTGCTGTCTGTCATAGAG | 146 | 55 |
R: TTGCGTTCTGTCTCTGCCAAGC | ||||
Ythdf2 | NM_145393.4 | F:TTGCCTCCACCTCCACCACAG | 111 | 55 |
R:CCCATTATGACCGAACCCACTGC | ||||
Setd2 | NM_001081340.2 | F: GGAGGCAGACACGGAGACAGAG | 139 | 55 |
R: ATCTGGTGGCTCCTGGCTTCTC | ||||
Gapdh | NM_008084.3 | F: CATGGCCTTCCGTGTTCCTA | 104 | 55 |
R: GCCTGCTTACCACCTTCTT |
RNA Extraction and RT-qPCR for S. aureus
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!