Pet 32a

The complete coding sequence of the PCV3 Cap protein (GenBank accession No. MK580468) was synthesized and optimized (Sangon Biotech, Shanghai, China) into pGEX-4T-1 and pET-32a vectors, and the recombinant plasmids pGEX-4T-1-Cap and pET-32a-Cap were thus obtained, respectively. The expression of GST-fused Cap and 6×His-tagged Cap proteins (namely GST-Cap and His-Cap, respectively) was achieved by transforming into E. coli BL21. Protein expression was induced with 1 mM isopropyl-β-galactopyranoside for 6 h at 37 °C. The bacterial precipitate was collected by centrifugal force at 5000× g and diluted in PBS. The target proteins were lysed via ultrasonication and collected via centrifugation. The recombinant proteins in the supernatant after sonication were purified using the GST-tag and His-tag Protein Purification Kits (CoWin, Taizhou, China) following the steps outlined in the instructions. The proteins were characterized using SDS-PAGE in 12.5% polyacrylamide gels. The determination of protein concentration was conducted via a BCA protein detection kit (Solarbio, Beijing, China).
In addition, to characterize the ability of mAbs to bind to the PCV3 Cap protein in multiple ways, the PCV3 Cap protein gene was synthesized and subcloned into the pCAGGS vector (Sangon Biotech, Shanghai, China), and the resultant protein was named pCAGGS-Cap.

The mutant gene was inserted into an express vector (pET-32a) by Sangon Biotech Co., Ltd (Shanghai, China), and the resulting recombinant plasmids were characterized by using polymerase chain reaction (PCR) (primers: forward, ATGACTAAAACAAAAATTATGGGCATATTAAAC; reverse, TTAAGAAAAATTGTGTCTTGCATTTTCA) and double digestion (BamHI and XhoI). The positive recombinant plasmids were transformed into the E. coli competent cell (BL21 D3) to express the mutant, and the subsequent purification was performed by using a Ni-agarose resin column as the mutant was fused with HIS-tag. After that, the pure mutant was analyzed by SDS-PAGE electrophoresis and characterized by western blotting analysis. The detailed expression, purification and characterization procedures were shown in our recent report (He, Liu, & Wang, 2021 (link)).

A fusion gene BLP was generated by concatenating the oligonucleotides encoding a duplicated Lys-Asn-Pro-Tyr peptide, a linker (GGGG), and albumin-binding peptide [27 (link)]. The gene was amplified by polymerase chain reaction (PCR) using primers obtained from Sangon Co. Ltd. (Shanghai, China). The PCR conditions were 30 cycles of 30 s at 95 °C, 30 s at 55 °C, and 1 min at 72 °C. The amplified gene was cloned into the prokaryotic expression vector pET-32a(+) (Sangon, Shanghai, China) and the resulting BLP expression plasmids were transformed into E. coli strain BL21 (DE3) (Stratagene, La Jolla, CA, USA). After induction with 24 μg/mL isopropyl β-D-thiogalactopyrano-side (IPTG; Sigma, St. Louis, MO, USA) and 0.01 g/mL saccharose (Sigma, St. Louis, MO, USA) for 20 h at 24.5 °C, the BLP fusion conjugate was purified using Ni-NTA affinity resin (ThermoFisher, Shanghai, China). The recombinant bacterial protein was separated on a 12% (v/v) SDS-PAGE gel and a 28 kDa band corresponding to the recombinant hybrid polypeptide, including the vector fusion protein (20 kDa) and the hybrid polypeptide (approx. 8 kDa), was isolated. Protein concentration was determined with a bicinchoninic acid (BCA) assay.