All reagents were used without purification. Iron(iii ) chloride hexahydrate (FeCl3·6H2O, 97%, Sigma-Aldrich), iron(ii ) chloride tetrahydrate (FeCl2·4H2O, ≥99%, Sigma-Aldrich), manganese(ii ) chloride tetrahydrate (MnCl2·4H2O, ≥98%, Daejung), hydrochloric acid (HCl, 35–37%, Samchun), ammonia solution (NH4OH, 28–30%, Samchun), polyacrylic acid (PAA, MW: 2000, 63 wt% aqueous solution, Acros Organics), sodium hydroxide (NaOH, 93%, Duksan), sodium citrate dihydrate (Na3C6H5O7·2H2O, ≥99%, Daejung), citric acid (C6H8O7, 99.5%, Samchun), sodium phosphate dibasic (Na2HPO4, 99%, Samchun), sodium phosphate monobasic dihydrate (NaH2PO4·2H2O, 98–102%, Samchun), sodium carbonate (Na2CO3, 99%, Samchun), sodium bicarbonate (NaHCO3, 99–100.5%, Samchun), fetal bovine serum (FBS, Merck Millipore), Dulbecco's modified eagle medium (DMEM, Welgene), penicillin–streptomycin (Pen–Strep, Gibco), saline (0.9% NaCl, JW Life Science), cell counting kit-8 (CCK-8, Sigma-Aldrich), and phosphate buffered saline (PBS, pH = 7.4, 10 mM, Sigma-Aldrich) were used.
Hydrochloric acid (hcl)
Manufactured by Samchun
Sourced in Germany, Cameroon, United States, Japan
Hydrochloric acid is a clear, colorless, and highly corrosive liquid. It is a common laboratory chemical used to perform various chemical reactions and analyses.
Automatically generated - may contain errors
Lab products found in correlation
Sodium hydroxide (naoh), by Samchun (15 mentions)
Ethanol, by Samchun (11 mentions)
Acetone, by Samchun (6 mentions)
Methanol, by Samchun (5 mentions)
Hydrogen peroxide, by Samchun (4 mentions)
Sodium carbonate, by Samchun (3 mentions)
Tetraethyl orthosilicate, by Merck Group (3 mentions)
Toluene, by Samchun (3 mentions)
N hexane, by Samchun (3 mentions)
Dimethyl sulfoxide (dmso), by Merck Group (3 mentions)
Sodium chloride (nacl), by Samchun (3 mentions)
Sulfuric acid, by Samchun (3 mentions)
Ammonia solution, by Samchun (2 mentions)
Sodium acetate, by Merck Group (2 mentions)
Dimethylformamide, by Merck Group (2 mentions)
Tetrahydrofuran, by Merck Group (2 mentions)
Hexamethyldisilazane, by Merck Group (2 mentions)
Ethyl acetate, by Samchun (2 mentions)
Potassium permanganate, by Merck Group (2 mentions)
Acetic acid, by Merck Group (2 mentions)
50 protocols using hydrochloric acid (hcl)
1
Synthesis of Iron-Based Nanoparticles
2
Synthesis of Titania-Silica Nanocomposites
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Iron chloride hexahydrate (FeCl3·6H2O), sodium citrate tribasic dehydrate, sodium acetate (NaAc), bisphenol-A, concentrated ammonia solution (28 wt%), t-butanol, titanium(iv ) isopropoxide (TIPO), TiO2 (P25, 20% rutile and 80% anatase) and tetraethyl orthosilicate (TEOS) were analytical grade and purchased from Sigma-Aldrich (USA). Sodium hydroxide (NaOH), hydrochloric acid (HCl, 36%), perchloric acid (HClO4), potassium bi-phthalate (C6H4COOKCOOH, 99.7%), ammonium molybdate ((NH4)6Mo7O24·4H2O, 99.0%), ethylene glycol and ethanol were purchased from Samchun Pure Chemicals. All chemicals were analytical grade and used as received without further purification. Corp. deionized water was used for all experiments.
3
Fabrication of Serotonin Aptamer Biosensor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
3,4-Ethylenedioxythiophene (EDOT), polyacrylonitrile (PAN), dimethylformamide (DMF), ferric chloride, 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMTMM), hexamethyldisilazane (HMDS), 3,4-Dimethoxythiophene, p-toluenesulfonic acid monohydrate (pTsOH·H2O), butylated hydroxytoluene (BHT), tetrahydrofuran (THF), and Sylgard 184 polydimethylsiloxane (PDMS) were obtained from Sigma–Aldrich. Ethanol, toluene, mEthanol, hexane (Hex), hydrochloric acid (HCl), and ethyl acetate (EtOAc) were obtained from Samchun. Sodium hydroxide (NaOH) was purchased from Daejung. (S)-Methyl 2,3-dihydroxypropanoate (Methyl glycerate) was purchased from Combi-Block. AZ5214E was obtained from Clariant. A serotonin aptamer with the sequence 5′-CGACTGGTAGGCAGAT AGGGGAAGCTGATTCGAGCGTGGGTCG[C6 Amine]-3′ was synthesized by Bioneer. Phosphate buffered saline (PBS) pH 7.4 (1 ×) was purchased from Gibco™, and simulated blood serum and artificial CSF were purchased from Biochemazone. All reagents and solvents were used as received without further treatment.
4
Synthesis and Characterization of Metal-Organic Composite Membranes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Graphite powder (<40 microns, synthetic), potassium permanganate (KMnO4, 99.3%), sulfuric acid (H2SO4, 95–98%), cobalt nitrate hexahydrate (Co(NO3)2·6H2O, 98%), nickel nitrate hexahydrate (Ni(NO3)2·6H2O, 98%), polyvinylpyrrolidone (PVP, average mol wt 40 000), 4,4′-bipyridine (BPY), and N,N-dimethylformamide (DMF, 99.8%) were purchased from Sigma-Aldrich. Hydrochloric acid (HCl, 35.0–37.0%), hydrogen peroxide (H2O2, 30.0–35.5%), sodium nitrates (NaNO3, 98.0%) were purchased from SAMCHUN. 5,10,15,20-tetrakis(4-carboxyl-phenyl)-porphyrin (TCPP, 97%) was purchased from Tokyo Chemical Industry Co. Ltd. Ethanol was purchased from Merck. An organic membrane filter (47 mm in diameter, Anodisc, Whatman) with a pore size of 0.25 μm was used for the preparation of the pristine and composite membranes through vacuum filtration processes. The deionized water was obtained from the Milli-Q System. All the chemicals were used as received without further purification.
5
Synthesis of PEG-Based Polyurethane Hydrogels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
α,ω-Bis-hydroxy-poly(ethylene glycol) (HO-PEG-OH, Mn = 2050 g/mol), hexamethylene diisocyanate (HDI), stannous octoate (Sn(Oct)2), dibutyltin dilaurate (DBTL), 1,4-bis(2-hydroxyethyl)piperazine (HEP), anhydrous chloroform, anhydrous toluene, and phosphate-buffered saline (PBS) were purchased from Sigma-Aldrich Co. (St. Louis, MO, USA). Diethyl ether, n-hexane, sodium hydroxide (NaOH, 5 N), and hydrochloric acid (HCl, 5 N) were obtained from Samchun Co. (Seoul, Korea). All other chemicals were of analytical grade and used as received. The water (18.2 MΩ cm resistivity at 25 °C) used in the experiments was prepared using a Milli-Q water purification system.
6
Radiolabeling of PSMA-Targeting Agents
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA)-PSMA-GUL (99.0%), 1,4,7-triazacyclononane-1,4,7-triacetic acid (NOTA)-PSMA-GUL (99.3%), and 175LuCl3 (99.9%) were obtained from CellBion (Seoul, Korea). Esomeprazole, sodium acetate, and acetic acid were purchased from Sigma Aldrich Chemical Co. (Milwaukee, WI, USA). Hydrochloric acid was obtained from Samchun Chemical Co., Ltd (Seoul, Korea). High-performance liquid chromatography (HPLC) grade acetonitrile, methanol, and water were purchased from J.T. Baker Co. (Philipsburg, NJ, USA).
7
Breast Cancer Cell Cytotoxicity Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TEOS, CTAB, dimethyl sulfoxide (DMSO), 3-(4,5-dimethylthoazol-2yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT), carbamazepine, and high-performance liquid chromatography (HPLC) grade acetonitrile (ACN) were purchased from Sigma Aldrich (St. Louis, MO, USA). Ethanol, toluene, NaOH, hydrochloric acid (HCl, 36–38 v/v%), and formic acid (>99.0%) were purchased from Samchun Pure Chemical (Pyungtaek, Korea). Human breast cancer cell (MCF-7) line was obtained from Korean cell line bank (Seoul, Korea). Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), penicillin–streptomycin, and trypsin–EDTA were purchased from Gibco® BRL (Gaithersburg, MD, USA). DOX was provided as a gift from Korea United Pharm Inc. (Seoul, Korea).
8
Synthesis of Gold and Platinum Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hydrogen tetrachloroaurate (III) hydrate (HAuCl4·nH2O, 99%) and hydrogen hexachloroplatinate (IV) hydrate (H2PtCl6·nH2O, 99%) were purchased from Kojima. Sodium borohydride (NaBH4, 98%) and silver nitrate (AgNO3, 99.8%) were purchased from Junsei. Sodium iodide (NaI, 99.5%) and L-ascorbic acid (AA, C6H8O6, 99.5%) were supplied by Sigma Aldrich. Hydrochloric acid (HCl, 35%), sodium hydroxide (NaOH, 98%), and sodium bromide (NaBr, 99.0%) were purchased from Samchun. Cetyltrimethylammonium bromide (CTAB, C19H42BrN, 95%) was purchased from Sigma-Aldrich. Cetyltrimethylammonium chloride (CTAC, C19H42ClN, 95%) was purchased from Tokyo Chemical Industry. All chemical materials were dissolved in distilled water (18.2 MΩ) prepared using a water purification system (Milli-Q, Millipore).
9
Synthesis and Characterization of Anion Exchange Membranes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ZnCl2, SnCl4, CMME, benzoyl peroxide (BPO), azobisisobutyronitrile (AIBN), N-bromosuccinimide (NBS), 1,1,2,2-tetrachloroethane (TCE), CDCl3, polysulfone (PSU) random copolymer (average Mn ∼ 22 000), bis(4-fluorophenyl) sulfone (DFDPS), 4,4′-(hexafluoroisopropylidene)diphenol (6F-BPA), 4,4′-dihydroxybiphenyl (BP), methyl iodide, Cs2CO3, K2CO3, CaCO3, deuterated chloroform (CDCl3) and N,N-dimethylsulfoxide (DMSO-d6), 1-methyl-2-pyrrolidinone (NMP), and N,N-dimethylacetamide (DMAc) were purchased from Sigma-Aldrich. Sodium chloride (NaCl), methanol and hydrochloric acid were supplied by Samchun Chemicals and used as received. Tetra(trimethylaminemethylene)-4,4′-dihydroxydiphenylether (TADHDPE) was synthesized following our previous report.27 (link) The FAA-3-30 membrane was purchased from FUMATECH as a reference AEM, and prior to its use, the counter ion was converted to chloride anion using aqueous 1 M NaCl solution.
10
Synthesis of Noble Metal Nanostructures
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gold(III) chloride trihydrate (HAuCl4 ∙ 3H2O ≥ 99.9% trace metals basis), silver nitrate (AgNO3, ≥99%), sodium tetrachloropalladate(II) (Na2PdCl4, 98%), rhodium(III) chloride hydrate (RhCl3 ∙ xH2O, 99.98% trace metals basis), chloroplatinic acid hexahydrate (H2PtCl6 ∙ 6H2O, ACS reagent, ≥37.50% Pt basis), gold(I) chloride (AuCl, 99.9% metals basis), gold(III) hydroxide, and sodium aurothiomalate hydrate, 3-mercaptopropionic acid (MPA, ≥99%), 6-mercaptohexanoic acid (MHA, 90%), L-cysteine (L-Cys, BioUltra, ≥98.5% (RT)), sodium borohydride (NaBH4, granular, 99.99 % trace metals basis), methanol (anhydrous, 99.8 %) were purchased from Sigma-Aldrich. Sodium hydroxide (NaOH, bead, >98.0 % (T), EP), hydrochloric acid (HCl, 35.0-37.0 %), ethanol (99.5 %), acetone (99.5 %), and 2-propanol (IPA, 99.5 %) were purchased from Samchun Chemicals. 4-Mercaptobenzoic acid (p-MBA, >95.0%) was purchased from TCI. All chemicals were used without further purification. Deionized water (18.2 MΩ cm) was used in all procedures.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!