Recombinant single-stranded AAV9 vectors were produced in our in-house facilities by a cotransfection using linear polyethylenimine 25 kDa (Polysciences, Warrington, PA) with 2 different plasmids: a plasmid containing the adenovirus helper genes, plus AAV2 rep and AAV9 cap, and a plasmid containing the transgenes of interest (either SynA53T, SynWT, eGFP, or without transgene) under the control of the human synapsin promoter, flanked by the AAV2 internal terminal repeat sequences. Viral vector particles were harvested from human embryonic kidney 293T cells (HEK293T) after 72 h posttransfection, resuspended in a lysis buffer (50 nM Tris–HCl, 150 nM NaCl, 2 mM MgCl2, 0.1% Triton X-100) and stored at − 80 °C until used. Viral particles were purified by ultracentrifugation in an iodoxanol gradient and were concentrated through centricon tubes (YM-100; Millipore, Bedford, MA). Viral titers were determined by quantitative PCR for viral genomic copies extracted from DBAse-treated viral particles using WPRE-directed primers (FW: CGCAACCCCACTGGTT and RV: AAAGCGAAAGTCCCGCAAAG). Obtained vector titers ranged from 1.8 × 1012 to 2 × 1012 vg/ml (viral genomes/ml).
Ym 100
Manufactured by Merck Group
Sourced in United States
The YM-100 is a laboratory centrifuge designed for general-purpose applications. It is capable of separating samples based on density differences. The centrifuge provides reliable and consistent performance for a variety of sample types.
Automatically generated - may contain errors
Lab products found in correlation
25 kda linear polyethylenimine, by Polysciences (1 mentions)
Superdex 200 pc 3.2 30, by GE Healthcare (1 mentions)
Smart system, by GE Healthcare (1 mentions)
Flag peptide, by Merck Group (1 mentions)
Anti flag m2 affinity gel, by Merck Group (1 mentions)
Command console software, by Thermo Fisher Scientific (1 mentions)
Genechip mirna 2.0 array, by Thermo Fisher Scientific (1 mentions)
Horse heart cytochrome c, by Merck Group (1 mentions)
Potassium cyanide, by Merck Group (1 mentions)
Catalase, by Merck Group (1 mentions)
Potassium ferrocyanide, by Merck Group (1 mentions)
Superoxide dismutase, by Merck Group (1 mentions)
Potassium phosphate monobasic and dibasic, by Merck Group (1 mentions)
Dodecyl maltoside, by Anatrace (1 mentions)
Horseradish peroxidase type 6 a, by Merck Group (1 mentions)
Potassium hydroxide, by Merck Group (1 mentions)
Potassium ferricyanide, by Merck Group (1 mentions)
7 protocols using ym 100
1
Production and Purification of AAV9 Vectors
2
Synthesis of Cy5.5-Modified Magnetic Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Cy5.5-modified Fe3O4 nanoparticles (Fe3O4-Cy) were obtained through the following steps. First, the amination of nanoparticles was accomplished using a click reaction. To elaborate, 2-aminoethanethiol (0.55 mg, 7.14 μmol) dissolved in water was mixed with an aqueous solution of tris(2–carboxyethyl) phosphine (6.58 mg, 22.96 μmol) and stirred for 5 min. After neutralizing the mixture with HEPES buffer (pH = 7.4, 1 M), it was added to the solution of PEGylated Fe3O4 nanoparticles (10 mg) and oscillated for 4 h. To eliminate excess 2-aminoethanethiol, the resulting solution was subjected to purification through ultrafiltration for three cycles using a 30 kDa MWCO centrifugal filter (Millipore YM-100). Subsequently, Cy5.5-NHS was coupled to the aminated nanoparticles. In brief, Cy5.5-NHS (0.5 mg, 0.71 μmol), dissolved in DMSO, was added to 10 mg of surface-aminated Fe3O4 nanoparticles and stirred overnight at room temperature. The resultant mixture was dialyzed for 72 h and ultrafiltered using 30 kDa ultrafiltration tubing to remove free Cy5.5-NHS and other reactants, yielding a solution of the Cy5.5-modified Fe3O4 nanoparticles.
3
Purification of FLAG-Wnt3a from Conditioned Medium
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Five-hundred mL of conditioned medium (C.M.) of FLAG-tagged Wnt3a (FLAG-Wnt3a)-expressing L cells in serum-free condition were prepared. HEPES buffer, pH7.4 (final 10 mM); EDTA, pH8.0 (final 1 mM); and protease inhibitors (final 1 mM PMSF, 5 μg mL−1 leupeptin, 10 μg mL−1 peptstatinA, and 5 μg mL−1 aprotinin) were added to the C.M. Debris was removed by centrifugation for 30 min at 14,000 × g, and the supernatant containing FLAG-Wnt3a was applied to an anti-FLAG M2 affinity gel (Sigma) column that had been equilibrated with 15 mM HEPES buffer, pH7.4-150 mM NaCl. The column was washed with 10 column bed volumes of the same buffer containing 0.1 mM n-Dodecyl-β-D-maltoside. The bound proteins were eluted with the same buffer containing 125 μg mL−1 FLAG peptide (Sigma). The eluate was concentrated 10–30 times with a Microcon centrifuge filter unit YM-100 (Millipore). Further purification was performed by using Superdex200 (PC3.2/30) gel filtration chromatography in a Smart-system (GE Healthcare). The elution of protein was profiled at 280 nm, and the eluate was sub-fractionated into 40-μL fractions.
4
Affymetrix GeneChip miRNA 2.0 Arrays Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Affymetrix GeneChip miRNA 2.0 Arrays (Santa Clara, CA, USA) were used and the standard protocols followed. The total number of mature miRNA probes per array is 15,644 from 131 organisms of which 847 are human (miRBase v15). Probe sets for human snoRNAs were derived from snoRNABAse and Ensembl Archive. In brief, total RNA (tRNA) was enriched using microcon columns (YM-100, Millipore, Watford, UK). 500ng of tRNA was diluted to 100μl with 10mM Tris pH8 and heated at 80°C for 3 minutes, then cooled on ice for 3 minutes. The microcon columns were then calibrated with 50ul of 10mM Tris pH8 and centrifuged (1500 rpm, 3 minutes). Diluted tRNA was then added to the column and centrifuged (13000 g, 7 minutes). RNA was labelled using the FlashTag Biotin RNA Labelling Kit (Genisphere, Hatfield, PA) following manufacturer protocol. GeneChip miRNA 2.0 Arrays (Affymetrix) were then processed using the GeneChip Hybridization, Wash, and Stain Kit with fluidics script FS450_0003. Scanning was performed using Affymetrix Command Console Software. Microarray data generated is MIAME (minimum information about a microarray experiment) compliant and the raw data has been deposited in the gene expression omnibus (accession number: GSE67689).
5
Isolation and Characterization of Cytochrome c Oxidase
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Potassium phosphate monobasic and dibasic, potassium hydroxide, potassium ferricyanide, potassium ferrocyanide, potassium sulfate, potassium cyanide, horse heart cytochrome c, superoxide dismutase (SOD), horseradish peroxidase type VI A, and catalase from bovine liver were purchased from Sigma-Aldrich, Triton X-100 (TX) was from Roche Diagnostics, dodecyl maltoside (DM) from Anatrace, Sepharose Q fast flow from Pharmacia Uppsala and hydrogen peroxide solution (~30%) was from Fluka.
Bovine heart cytochrome c oxidase was isolated from mitochondria following the modified method [86 (link)] into 10 mM Tris, pH 7.6, 50 mM K2SO4, and 0.1% TX. To change TX for DM detergent, the purified enzyme was diluted and reconcentrated using microfilters (YM 100, Millipore, cut-off 100 kDa) with the buffer containing 0.1% DM.
Isolated CcO was frozen in liquid nitrogen and stored at −80 °C. The concentration of CcO was determined from the UV-Vis absorption spectrum of the oxidized enzyme using an extinction coefficient ε (424 nm) = 156 mM−1cm−1 and ε (428 nm) = 169 mM−1cm−1 for the cyanide-ligated CcO (CcO.CN) [87 (link)].
Bovine heart cytochrome c oxidase was isolated from mitochondria following the modified method [86 (link)] into 10 mM Tris, pH 7.6, 50 mM K2SO4, and 0.1% TX. To change TX for DM detergent, the purified enzyme was diluted and reconcentrated using microfilters (YM 100, Millipore, cut-off 100 kDa) with the buffer containing 0.1% DM.
Isolated CcO was frozen in liquid nitrogen and stored at −80 °C. The concentration of CcO was determined from the UV-Vis absorption spectrum of the oxidized enzyme using an extinction coefficient ε (424 nm) = 156 mM−1cm−1 and ε (428 nm) = 169 mM−1cm−1 for the cyanide-ligated CcO (CcO.CN) [87 (link)].
6
Quantifying Encapsulation Efficiency of Cubosomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The percentage of drug incorporated into cubosomes was determined by a centrifugal ultrafiltration method.6 (link) Experiments were performed using YM-100 centrifugal tubes from Millipore Corporation (Billerica, MA, USA). After centrifuging the cubosome dispersion at 15,000 rpm for 30 minutes, the free AmB with filtrate was removed through the bottom of the reservoir of the centricon, with a certain pore size. Then, the retentate in the reservoir was diluted with methanol, and the entrapped AmB content was analyzed via high performance liquid chromatography (HPLC).
7
Heparin Determination and Release in SLNs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The determination of the heparin loaded in H-SLN and PEC-SLN was performed by using the colorimetric method based on the Azure II dye [19] (link). An aliquot of freeze-dried SLN (10 mg) was dissolved in 1 mL of chloroform; then 3 mL of deionized water or carbonate buffer solution pH 9.2 was added for H-SLN or PEC-SLN, respectively. Heparin was determined in the aqueous solution by the colorimetric assay. Typically, aliquots (500 µl) of aqueous phase were reacted with 4.5 mL of the Azure II solution (0.01 mg/mL) and assayed in triplicate at 654 nm by UV spectroscopy. Drug loading (DL) and encapsulation efficiency (EE) values are averaged on three determinations and calculated as follows
x 100
(1)
Heparin in vitro release studies were performed by incubating at 37 °C PEC-SLN or H-SLN (50 mg) in HCl 0.1N (50 mL) at pH 1 (for the first 3h), then at pH 6.8 (for the followed 6h) and finally at pH J o u r n a l P r e -p r o o f 7.5 (followed 15h) in order to simulate the passage through gastrointestinal tract. At various time intervals, 0.5 mL samples were withdrawn and replaced with fresh solvent to maintain constant volume and filtered upon centrifugation at 13,000g using microcon filter devices (YM 100, Millipore Corporation, Bedford, MA, USA). The supernatant was removed and assayed for heparin according to the Azure II colorimetric method.
x 100
(1)
Heparin in vitro release studies were performed by incubating at 37 °C PEC-SLN or H-SLN (50 mg) in HCl 0.1N (50 mL) at pH 1 (for the first 3h), then at pH 6.8 (for the followed 6h) and finally at pH J o u r n a l P r e -p r o o f 7.5 (followed 15h) in order to simulate the passage through gastrointestinal tract. At various time intervals, 0.5 mL samples were withdrawn and replaced with fresh solvent to maintain constant volume and filtered upon centrifugation at 13,000g using microcon filter devices (YM 100, Millipore Corporation, Bedford, MA, USA). The supernatant was removed and assayed for heparin according to the Azure II colorimetric method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!