Uv crosslinker

Isolation of small RNAs and northern blot experiments were performed as previously described (Wu et al., 2013 (link)). Briefly, small RNAs were isolated from yeast cultures grown to early log phase by addition of equal volumes cold TSE buffer (0.01 M Tris pH 7.5, 0.01 M EDTA, 0.1 M sodium chloride) and TSE saturated phenol. Samples were incubated at 55°C for 20 min with vortexing every 3 min, then placed on ice for 10 min. Aqueous phase was extracted after centrifugation, re-extraction with phenol was performed, and RNA was precipitated overnight in ethanol at –80°C. Then, 2.5 ug of RNA was separated on 10% TBE-Urea gels, gels were stained with Apex safe DNA gel stain to visualize 25S and 18S rRNA, and then transferred to Hybond N⁺ membrane (Amersham). RNA was crosslinked to membranes at 2400 J/m² using UV crosslinker (VWR), and tRNA were detected using digoxigenin-labeled (DIG) probes. Mean integrated intensity values were measured for I and P bands using FIJI (Schindelin et al., 2012 (link)) and normalized to background signal in each lane.
The sequence of northern blot probe targeting precursor and mature isoforms of tRNA^Ile_UAU used in Figures 2 and 4 is as follows: GGCACAGAAACTTCGGAAACCGAATGTTGCTATAAGCACGAAGCTCTAACCACTGAGCTACACGAGC.

Isolation of small RNAs and Northern blot experiments were performed as previously described (Wu, Huang et al. 2013 (link)). Briefly, small RNAs were isolated from yeast cultures grown to early log phase by addition of equal volumes cold TSE buffer (0.01M Tris pH7.5, 0.01M EDTA, 0.1M sodium chloride) and TSE saturated phenol. Samples were incubated at 55°C for 20min with vortexing every 3 min then placed on ice for 10 min. Aqueous phase was extracted after centrifugation, re-extraction with phenol was performed, and RNA was precipitated overnight in ethanol at −80°C. 2.5ug of RNA was then separated on 10% TBE-Urea gels, gels were stained with Apex safe DNA gel stain to visualize 25S and 18S rRNA and then transferred to Hybond N⁺ membrane (Amersham). RNA was crosslinked to membranes at 2400J/m² using UV Crosslinker (VWR) and tRNA were detected using digoxigenin-labeled (DIG) probes. Mean integrated intensity values were measured for I and P bands using FIJI (Schindelin, Arganda-Carreras et al. 2012 (link)) and normalized to background signal in each lane.
Sequence of Northern blot probe targeting precursor and mature isoforms of tRNA^Ile_UAU used in Figure 2 and 4 is as follows:
GGCACAGAAACTTCGGAAACCGAATGTTGCTATAAGCACGAAGCTCTAACCACTGAGCTACACGAGC.

Isolation of small RNAs and Northern blot experiments were performed as previously described (Wu, Huang et al. 2013 (link)). Briefly, small RNAs were isolated from yeast cultures grown to early log phase by addition of equal volumes cold TSE buffer (0.01M Tris pH7.5, 0.01M EDTA, 0.1M sodium chloride) and TSE saturated phenol. Samples were incubated at 55°C for 20min with vortexing every 3 min then placed on ice for 10 min. Aqueous phase was extracted after centrifugation, re-extraction with phenol was performed, and RNA was precipitated overnight in ethanol at −80°C. 2.5ug of RNA was then separated on 10% TBE-Urea gels, gels were stained with Apex safe DNA gel stain to visualize 25S and 18S rRNA and then transferred to Hybond N⁺ membrane (Amersham). RNA was crosslinked to membranes at 2400J/m² using UV Crosslinker (VWR) and tRNA were detected using digoxigenin-labeled (DIG) probes. Mean integrated intensity values were measured for I and P bands using FIJI (Schindelin, Arganda-Carreras et al. 2012 (link)) and normalized to background signal in each lane.
Sequence of Northern blot probe targeting precursor and mature isoforms of tRNA^Ile_UAU used in Figure 2 and 4 is as follows:
GGCACAGAAACTTCGGAAACCGAATGTTGCTATAAGCACGAAGCTCTAACCACTGAGCTACACGAGC.