Precision plus protein all blue prestained protein standard

Precision Plus Protein All Blue Prestained Protein Standards (Bio-Rad) were used as molecular weight markers. Proteins were separated using a 4–15% Mini-PROTEIN TGX Stain-Free Protein Gel (Bio-Rad) at 250 V for 25 min. The amount of sample to be loaded per lane for the quantitative Western blot analysis of the target proteins was determined by evaluating their respective linear dynamic range as a function of the total protein content (Fig S5). This evaluation of the linear dynamic range was perfomed with a serial dilution of a mixture of an equal amount (per total protein) of the BTHS and the control PNS fractions.

BsAb samples were subjected to non-reducing sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) to determine whether the disulfide bonds between HC and LC were correctly formed. Each 1 μg sample was mixed with SDS Sample Buffer Solution (2ME-) (× 4) (Wako) and heated at 95 °C for 2 min, and then loaded onto a Mini-PROTEAN TGX gel (4–20%, 15 well) (Bio-Rad) alongside a molecular weight marker (Precision Plus Protein™ All Blue Prestained Protein Standards, Bio-Rad). Electrophoresis was performed using a Power PAC 3000 (Bio-Rad) at a constant voltage of 200 V for 35 min. The gel was then removed from the cassette and stained with Quick-CBB (Wako), followed by destaining in Milli-Q water. The stained gel was imaged using a ChemiDoc Touch MP (BIO-Rad).

Cleared cell lysates were boiled for 5 min at 95°C and loaded on 8–12% SDS polyacrylamide gels. As a protein marker the Precision Plus Protein All Blue Prestained Protein Standards (1610373, Biorad) was used. After SDS PAGE, the proteins were transferred on a nitrocellulose membrane (Premium 0.45 μm, 10600003, Amershan) for 70 min at 350 mA in transfer buffer. Depending on the antibody, unspecific binding was blocked by incubating the membrane in either 5% milk in PBS-T or TBS-T buffer or in 5% bovine serum albumin (BSA) in TBS-T buffer. The membranes were incubated with the primary antibody on a roller at 4°C over night or 1 h at RT. After three washing steps in the corresponding buffer, the membranes were incubated for 1 h at RT in the secondary horseradish peroxidase (HRP)-conjugated antibody. Primary and secondary antibodies used for western blot are listed above (section antibodies). To visualize the specific detection of proteins, the membranes were developed in a LAS-3000 Imager (Fujifilm) using either self-made enhanced chemiluminescence (ECL) solution 1 and 2, which were mixed in a ratio of 1:1, or the SuperSignal West Femto Maximun Sensitivity Substrate (34096, Thermo Scientific).

The regulatory segment of XdpR from the A. bohemicum R89-1 genome [19 ] was a short double-stranded DNA probe of 26 nucleotides obtained as complementary annealed primers (Fwd: CAATCATGATGATCGTCATGAATATA) with the negative control mutated (Fwd: CAATTATGATGATCGTTATGAATATA). The XdpR protein with an N terminal His tag was purified as described above for XdpB, concentrated to 0.5 mg/ml and preincubated with DNA (20 μM) for 1 h at room temperature. Electrophoretic separations were done in 7% PAGE gels in a blue native arrangement [29 (link)]. Precision plus protein All Blue Prestained protein standards (Bio Rad) and XdpR with 1% deoxycholate were used as markers. The gel was stained with ethidium bromide (1 μg/ml) in a TAE buffer for 2 h and destained for 30 min. Ethidium bromide fluorescence was recorded by MF-ChemiBIS 2.0 (DNR Bio-Imaging Systems).

Purified pili and molecular weight markers (Precision Plus Protein™ All Blue Prestained Protein Standards, Biorad, Hercules, USA; CandyCane glycoprotein molecular weight standards, Thermo Fisher, Waltham, USA) were separated by SDS-PAGE (Mini Protean TGX 4–20%, Biorad). Protein was stained using InstantBlue™ Protein Stain (Expedeon Ltd, Cambridge, UK) or Pro-Q™ Emerald 300 Glycoprotein Gel and Blot Stain Kit (Thermo Fisher). For the lectin analysis, after SDS-PAGE proteins were transferred to PVDF membranes (Trans-Blot Turbo System, Biorad). Blots were blocked and incubated with biotinylated lectins (10 μg/ml; Vector Laboratories, Burlingame, USA) according to the manufacturer’s instructions, followed by incubation with IRDye 800CW Streptavidin (LI-COR, Lincoln, USA) and imaging using an Odyssey Fc (LI-COR).

MMP activity in conditioned medium of cultured fibroblasts was assessed by gel electrophoresis zymography using Novex 10% zymogram (Gelatin) protein gels (Invitrogen AS, Carlsbad, CA, USA). Equal volumes of samples were mixed with 1% (w/v) SDS sample buffer under non-reducing conditions, and loaded onto the gels. The gels were electrophoresed at 30 mA until 30 min after the bromophenol blue dye had run off the gel. The gels were washed 2 x 15 min in renaturing buffer (50 mM Tris-HCl pH 8.0, 5mM CaCl₂, 2.5% (v/v) Triton X-100), 1 x 15 min in incubating buffer (50mM Tris-HCl pH 7.5, 5 mM CaCl₂) at room temperature, and then incubated in incubating buffer for 16 h at 37°C. Gels were stained in staining solution (0.1% Coomassie brilliant blue R-250 (w/v), 50% methanol, 7% acetic acid) for 1 h and destained in 7% (v/v) acetic acid, 20% (v/v) methanol until gelatinolytic activity appeared as a clear band on a blue background. Precision plus protein all blue prestained protein standards (Bio-Rad, Hercules, CA, USA) were also applied on the same gels for assignment of molecular mass. Images of the gels were scanned with an Epson perfection 4990 Photo scanner (Epson America Inc., CA, USA), and files were processed using Adobe Photoshop CS5.1. When necessary, adjustment in brightness and contrast were performed across the entire image.