Pre-designed small interfering RNA (siRNA) directed against human TCHHL1 (s43057 and s43059) and Kruppel-like factor 4 (KLF4; s17795) and negative control siRNA were purchased from Life Technologies (Carlsbad, CA). An epidermal growth factor receptor (EGFR) inhibitor (AG 1478) was purchased from Abcam (Cambridge, UK). An antibody against an oligopeptide (HPQRERLVLQREASTTKQ) corresponding to part of the C-terminal region of TCHHL1 was previously generated12 (link). Antibodies against extracellular signal-regulated kinase 1/2 (ERK1/2; #4695), phospho-ERK1/2 (#4370), stress-activated protein kinase/c-jun N-terminal kinase (SAPK/JNK; #9252), phospho-SAPK/JNK (#4668), p38 mitogen-activated protein kinase (p38 MAPK; #8690), phospho-p38 MAPK (#4511), v-akt murine thymoma viral oncogene homolog (AKT; #9272), phospho-AKT (#9271), signal transducers and activator of transcription 3 (STAT3; #9132), phospho-STAT3 (#9145), EGFR(#4267), phospho-EGFR (#4407) and β-Actin (#4967) were purchased from Cell Signaling Technology Japan, K.K. (Tokyo, Japan). Antibodies against cytokeratin-10 (M7002), Ki67 (M7240), and p53 (M7001) were purchased from DAKO (Carpinteria, CA). Antibodies against human cytokeratin-14 (ab7800) and filaggrin (ab218863), and antibodies against transglutaminase1 (PA5-59088) were purchased from Abcam and Thermo Fisher Scientific Inc. (Waltham, MA), respectively.
Ag1478
Manufactured by Abcam
Sourced in China, United States
AG1478 is a small molecule inhibitor that selectively blocks the tyrosine kinase activity of the epidermal growth factor receptor (EGFR). It functions by inhibiting EGFR autophosphorylation and downstream signaling.
Automatically generated - may contain errors
Lab products found in correlation
Anti hcrp 1 rabbit polyclonal antibodies, by Proteintech (2 mentions)
Apyrase, by Merck Group (2 mentions)
Phospho akt, by Cell Signaling Technology (1 mentions)
β actin, by Cell Signaling Technology (1 mentions)
Ab7800, by Abcam (1 mentions)
Phospho stat3, by Cell Signaling Technology (1 mentions)
Virapower mix, by GeneCopoeia (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Lv3 pglv h1 gfp puro, by GenePharma (1 mentions)
Cisplatin, by Merck Group (1 mentions)
Palbociclib, by Merck Group (1 mentions)
Taxol, by Merck Group (1 mentions)
Mcl 1, by Cell Signaling Technology (1 mentions)
Mk 2206, by Selleck Chemicals (1 mentions)
Sb202190, by Merck Group (1 mentions)
Dasatinib, by Merck Group (1 mentions)
Recombinant human fgf7, by R&D Systems (1 mentions)
Phospho p38, by Cell Signaling Technology (1 mentions)
Phospho c raf, by Cell Signaling Technology (1 mentions)
Phospho erk, by Santa Cruz Biotechnology (1 mentions)
9 protocols using ag1478
1
TCHHL1 and KLF4 siRNA Knockdown Protocol
2
Lentiviral RIN1 Knockdown and EGFR Inhibition
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Flag‐tagged Rab25 (LPP‐T4697‐Lv121‐200), Flag‐tagged RIN1 (LPP‐T2755‐Lv121‐200) and their corresponding control vectors were purchased from GeneCopoeia (Rockville, MD, USA). Lentiviral shRNA targeting RIN1 (LV3‐p GLV‐h1‐GFP‐puro) and control empty vector were synthesized at Genepharma (Shanghai, China). The target sequence of RIN1 used to construct a Lentiviral shRNA was 5′‐ ACGTTCCTCGTGCGGAAATCT‐3′. Vectors were packaged in 293T cells using ViraPower Mix (GeneCopoeia). After culturing for 48 h, lentiviral particles in the supernatant were harvested and filtered by centrifugation at 500× g for 10 min, and then transfected into ccRCC cells. The cells were cultured under puromycin (2 μg/mL) selection for 2 weeks, at which point real‐time PCR was used to determine the level of RIN1. The siRab25 (5′‐GGAGCUCUAUGACCAUGCU‐3′) oligonucleotides were synthesized at Genepharma. Transfection of oligonucleotides was performed using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's instructions. EGFR inhibitor AG1478 was purchased from Abcam (Shanghai, China).
3
Anti-cancer Drug Efficacy Testing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The anti-cancer drugs used in this study consisted of EGFR Inhibitor AG1478 (Cat No: ab141438 Abcam, Cambridge, UK), Cisplatin (Cat No: P4394, Sigma-Aldrich, St. Louise, MA, USA), CDK4/6 inhibitor Palbociclib (Cat No: PZ0383; Sigma-Aldrich), and Taxol (Cat No: T7402; Sigma-Aldrich). These were used to test treatment efficacy [27 (link)]. All other reagents were purchased from Sigma-Aldrich unless it is specified otherwise.
4
Antibody-based Regulation of AKT and EGFR Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Anti-HCRP-1 rabbit polyclonal antibodies were obtained from Proteintech (Wuhan, China). Rabbit monoclonal antibodies to AKT (#9272), p-AKT (Ser473, #9271), p-EGFR (Tyr1173, #2234), FoxO3a (#12829), p-FoxO3a (Ser253, #9466), Bcl-2 (#2872), and Mcl-1 (#4572) were purchased from Cell Signaling Technology (Shanghai, China). Antibodies against EGFR (sc-03-G), ERK (sc-271269), and p-ERK (Tyr204, sc-7382) were purchased from Santa Cruz (CA, USA). Mouse and rabbit anti-β-actin were obtained from Boster Biotechnology (Wuhan, China). Anti-BIM rabbit polyclonal antibody (BS64039) was ordered from Bioworld (Shanghai, China). AKT inhibitor, MK-2206 was obtained from Selleck (HOU, USA) and EGFR inhibitor, AG1478 was purchased from Abcam (Shanghai, China).
5
Metalloprotease Inhibitor DPC 333 Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The metalloprotease inhibitor DPC 333 ((2R)‐2‐((3R)‐3‐amino‐3 (4‐[2‐methyl‐4‐quinolinyl) methoxy] phenyl)‐2‐oxopyrrolidinyl)‐N‐hydroxy‐4‐methylpentanamide)) (DPC) was a gift from Dr. Carl P. Blobel (Weill Cornell Medicine, Graduate School of Medical Sciences, NY, USA) and diluted in DMSO to the indicated concentrations. The following intracellular signalling inhibitors were used: AG1478 (#141438, Abcam, USA); DAPT (#D5942), SB202190 (#S7067), CRM197 (#D2189), Dasatinib (#CDS023389) and G1254023X (#SML0789) obtained from MilliporeSigma, USA; LY294002 (#154447‐36‐6) and U0126 (#109511‐58‐2) obtained from Calbiochem, USA and recombinant human FGF7 (# 251‐KG, R&D Systems, USA).
6
Antibody Panel for HCRP-1 and MAPK Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Anti-HCRP-1 rabbit polyclonal antibodies were purchased from proteintech (Wuhan, China). Rabbit monoclonal antibodies to MMP-2, MMP-9, p38, phospho-p38, C-Jun amino terminal kinase (JNK), phospho-JNK, MEK1/2, phospho-MEK1/2, c-Raf, phospho-c-Raf, Ras and phospho-Ras were purchased from Cell Signaling Technology (Beverly, MA). Antibodies against EGFR, phospho-EGFR (Tyr1173), ERK and phospho-ERK were from Santa Cruze (CA, USA). Mouse anti-β-actin was from Boster Biotechnology (Wuhan, China). ERK1/2 inhibitor, PD98059 and EGFR inhibitor, AG1478 were from Abcam (Shanghai, China).
7
Pharmacological Reagents for Cell Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ONO-AE3-208, PF-04418948, clozapine N-oxide, and PGE2 were purchased from Cayman Chemical. BAPTA-AM was obtained from Enzo Life Sciences. PD0325901, mitomycin C, and indomethacin were purchased from FUJIFILM Wako Pure Chemical Corp. AG1478 was purchased from BioVision Inc. Apyrase and EGF were obtained from Sigma-Aldrich. H-89 was purchased from Seikagaku Corp. The DREADD ligand, clozapine N-oxide, was purchased from Cayman Chemical. Flurbiprofen axetil was purchased from KAKEN Pharmaceutical.
8
Signaling Pathways Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ATP, apyrase, suramin, and epidermal growth factor (EGF) were purchased from Sigma‐Aldrich (St. Louis, MO). Capsaicin, 4α‐phorbol 12,13‐didecanoate (4α‐PDD) and carbachol were purchased from Wako Pure Chemical (Osaka, Japan). Trametinib was purchased from LC Laboratories (Woburn, MA). Pyridoxalphosphate‐6‐azophenyl‐2′,4′‐disulfonic acid (PPADS) was purchased from Abcam (Cambridge, MA). AG1478 was purchased from BioVision Inc. (Milpitas, CA).
9
Chicken Cecal Explant Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Methods for chicken ceca explant cultures were adapted from an ex vivo colon explant model for mice13 and are summarized in Supplementary Fig. 1 . Briefly, 0.1 g tissue pieces from the ceca of 21-day-old chickens were incubated in antibiotic-treated Dulbecco’s modified eagle medium (DMEM) for 30 min at 39.5 °C (5% CO2). Explant tissues were then washed with antibiotic-free DMEM to remove residual antibiotics, individually transferred to 24-well plates, and incubated in DMEM with 0 or 1 µM reserpine for six hours at 39.5 °C (5% CO2). Alternatively, to confirm reserpine-mediated signaling pathways, tissues were incubated with norepinephrine (1.32 mg/ml or 1.32 µg/ml), beta-adrenergic receptor inhibitors ICI-118551 (β2; 1 µM; MedChemExpress, LLC) or L-748337 (β3; 1 µM; R&D Systems), U0126 (MEK1/2 inhibitor; 20 µM; Invivogen), human recombinant EGF (200 ng/ml; Biotang Inc), AG-1478 (EGFR tyrosine kinase inhibitor; 1 µM; BioVision), or rapamycin (mTOR pathway inhibitor; 10 ng/ml or 1000 ng/ml).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!