Amperase uracil n glycosylase

Manufactured by Thermo Fisher Scientific

Sourced in United States

AmpErase Uracil N-Glycosylase is a laboratory enzyme that removes uracil residues from DNA. It is used in PCR assays to prevent the amplification of carryover contaminants from previous experiments.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Uracil-N-glycosylase (15 citations) Uracil (11 citations) TaqMan Universal Master Mix with no Amperase Uracil N-glycosylase (UNG) (4 citations)

8 protocols using amperase uracil n glycosylase

Quantitative PCR for CAR Transduction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was isolated directly from the PB of patients using a QIAamp DNA Blood Mini Kit (Qiagen NV, Venlo, the Netherlands). Quantitative real-time PCR was performed in triplicate using the ABI 2 TaqMan Universal Master Mix in a 7500 real-time PCR system (Thermo Fisher Scientific, Waltham, MA, USA) with AmpErase uracil-N-glycosylase (Thermo Fisher Scientific).
To determine the copy number per unit DNA, we set up a six-point standard curve consisting of 10-fold serial dilutions of purified CAR plasmid containing 10⁻⁴ to 10⁻⁹ copies/mL. Primers/probes specific for the anti-CD19 CAR transgene and an internal control gene were used as described previously.

Yang F., Zhang J., Zhang X., Tian M., Wang J., Kang L., Qiu H, & Wu D. (2019). Delayed remission following sequential infusion of humanized CD19- and CD22-modified CAR-T cells in a patient with relapsed/refractory acute lymphoblastic leukemia and prior exposure to murine-derived CD19-directed CAR-T cells. OncoTargets and therapy, 12, 2187-2191.

+ Open protocol

+ Expand

Enhancing DNA Degradation Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

To investigate if the use of uracil DNA glycosylase enhances the sensitivity of detecting DNA degradation, blood spots on cellulose pads were stored at RT for up to 316 days and extracted at 82 time points during this period. DNA was extracted in duplicates at each time point: One DNA extract was treated with AmpErase™ Uracil N-Glycosylase (UNG, Thermo Fisher Scientific) for 20 min at 50 °C, while the other remained untreated. DNA concentration in each extract and respective degradation indices were analyzed using the PowerQuant System as described above.
To evaluate if results can be confirmed when using an alternative quantification kit, the UNG experiment was repeated using a subset of samples (stored at RT for up to 176 days with 53 time points). Both UNG-treated and untreated DNA extracts were quantified using the Investigator Quantiplex^® Pro Kit (Qiagen, Hilden, Germany) following manufacturer’s recommendations.

Schulze Johann K., Bauer H., Wiegand P., Pfeiffer H, & Vennemann M. (2022). Detecting DNA damage in stored blood samples. Forensic Science, Medicine, and Pathology, 19(1), 50-59.

+ Open protocol

+ Expand

Real-Time PCR of Environmental DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

The real-time PCR was conducted using the Applied Biosystems StepOnePlus Real-Time PCR System (Thermo Fisher Scientific). Each reaction well was prepared by mixing 2 µl of the eDNA sample with 10µl of TaqMan Environmental Master Mix 2.0 (Thermo Fisher Scientific), 0.1 µl of AmpEraseUracil N-Glycosylase (Thermo Fisher Scientific), 9 µl of distilled water, and 1 µl of primer-probe mix. The primer-probe mix consists of 18 µM forward and reverse primers and 2.5 µM probe. The solution was first placed in 50 °C for 2 min, followed by 95 °C for 10 min, followed by 55 cycles of 95 °C for 15 s and 60 °C for 60 s.
Real-time PCR was repeated three times for each sample, along with filtration blank, positive control and negative control. The PCR products with amplification response were then assessed using Sanger sequencing. Sections of the resulting sequences with low quality base scores (

Mori K., Imamura A., Hirayama I, & Minamoto T. (2023). Detection of Echinococcus multilocularis in repurposed environmental DNA samples from river water. PeerJ, 11, e15431.

+ Open protocol

+ Expand

Limit of Detection and Quantification for A. japonica

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time PCR was performed to determine the limit of detection (LOD) and the limit of quantification (LOQ) of the assay with StepOne™ Real-Time PCR System (Thermo Fisher Scientific). Commercially synthesized cloned DNA including the target sequence of A. japonica was used as a DNA template (hereafter standard DNA; see Online Resource Table S2 for the product details). Total reaction volume of PCR was 15 µl which included 900 nM of each primer, 125 nM of probe, 7.5 µl of TaqMan™ Environmental Expression Master Mix 2.0 (Life Technologies), 0.075 µl of AmpErase Uracil N-Glycosylase (Thermo Fisher Scientific) and 2 µl template of standard DNA with known copies of the target sequence. Each concentration of the standard DNA at 30,000, 3000, 300, 30, and 20 copies per reaction were tested in triplicate, and the other concentrations, 10, 3, and 1 copy per reaction were tested with 6 replications. A triplicate of NTC was also included which contained 2 µl of ultrapure water in place of the standard DNA.

Kasai A., Takada S., Yamazaki A., Masuda R, & Yamanaka H. (2024). The effect of temperature on environmental DNA degradation of Japanese eel. Fish Sci., 86(3).

+ Open protocol

+ Expand

Quantitative PCR for Japanese Eel eDNA Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time quantitative PCR targeting on Japanese eel was conducted in 15-µl reaction volumes which included 900 nM of forward and reverse primers (Aja-Dlp-F2 and Aja-Dlp-R3, respectively), 125 nM of a probe (Aja-Dlp-Pr-FAMMGB), 7.5 µl of TaqMan™ Environmental Expression Master Mix 2.0 (Thermo Fisher Scientific), 0.075 µl of AmpErase Uracil N-Glycosylase (Thermo Fisher Scientific) and 2 µl of template eDNA sample. A dilution series of a standard DNA was included in each PCR test as a quantification standard with the copy numbers diluted to 30,000, 3000, 300, and 30 copies per reaction. All samples and standard DNA were run in triplicate. All PCR runs included triplicates of NTCs which included 2 µl of ultrapure water instead of template DNA. Thermal cycle settings for PCR were 2 min at 50 °C, 10 min at 95 °C and 55 cycles of 15 s at 95 °C and 60 s at 60 °C.

Kasai A., Takada S., Yamazaki A., Masuda R, & Yamanaka H. (2024). The effect of temperature on environmental DNA degradation of Japanese eel. Fish Sci., 86(3).

+ Open protocol

+ Expand

Quantifying Apoptosis-Regulating Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The rotor gene system (Corbett Research, Sydney, Australia) was used to run quantitative real-time polymerase chain reaction. The absolute quantification assay was chosen to analyze hTERT expression. PCR was performed using a total reaction volume of 20 μL containing 1x TaqMan universal master mix with AmpErase uracil N-glycosylase (to prevent the re-amplification of carry-over PCR products; Applied Biosystems, Foster City, CA, USA), 600 nM of each primer, 200 nM TaqMan probe, and 1 μL of unknown cDNA or 2 μL of the standard template. All of the samples (unknown or standard) were run in duplicate and accompanied by a non-template control. Thermal cycling conditions included 2 minutes at 50°C and 10 minutes at 95°C, followed by 45 cycles at 95°C for 15 seconds and 60°C for 60 minutes.
The primers for survivin were as follows: sense primer 5′-ATGGGTGCCCCGACGTTG-3′; reverse primer 5′-AGAGGCCTCAATCCATGG-3′. The XIAP primers were as follows: sense primer 5′-GGCCATCTGAGACACATGCAG-3′; reverse primer 5′-GCATTCACTAGATCTGCAACC-3′. The cIAP1 primers were as follows: sense primer 5′-GCCTGATGCTGGATAACTGG-3′; reverse primer 5′-GGCGACAGAAAAGTCAATGG-3′. The cIAP2 primers were as follows: sense primer 5′-GGACAGGAGTTCATCCGTCAA-3′; reverse primer 5′-GGGCTGTCTGATGTGGATAGC-3′. The cIAP2 primers were as follows: sense primer 5′-GCATTGGAATCAGACAGCAC-3′; reverse primer 5′-CCACGACGTAGTCCATGTTC-3′.

Choi J.Y., Yoon H., Na G., Choi Y.J., Shin C.M., Park Y.S., Kim N, & Lee D.H. (2017). Evaluation of the Expression of the Inhibitor of Apoptosis Protein Family and Human Telomerase Reverse Transcriptase in Patients With Advanced Colorectal Adenoma. Journal of Cancer Prevention, 22(2), 98-102.

+ Open protocol

+ Expand

Real-time PCR Detection of C. gallinacea

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The presence of C. gallinacea DNA was examined using a real-time PCR developed by Laroucau et al. [33 (link)] and further described by Heijne et al. [16 (link)]. This PCR detects the enoA gene with a sensitivity of 5 copies/reaction, using the primer sequences FW “CAATGGCCTACAATTCCAAGAGT” and REV “CATGCGTACAGCTTCCGTAAAC” and probe sequence “FAM-ATTCGCCCTACGGGAGCCCCTT-TAMRA”. Each reaction consisted of 5 µL of the DNA template, 10 µL of TaqMan™Fast Universal PCR Master Mix (2×) (Applied Biosystems, Dublin, Ireland), 1 µM of the forward and reverse primers, 0.2 µM of the probe, and 1 unit of AmpErase™ Uracil N-glycosylase (Applied Biosystems). DNA amplification was performed with the following cycling conditions: 37 °C for 5 min, 95 °C for 20 s, followed by 50 cycles of 95 °C for 3 s and 60 °C for 30 s. According to validation with an in-house control plasmid, samples with a Ct value lower than 38 were considered positive.

De Meyst A., De Clercq P., Porrez J., Geens T., Braeckman L., Ouburg S., Morré S.A, & Vanrompay D. (2024). Belgian Cross-Sectional Epidemiological Study on Zoonotic Avian Chlamydia spp. in Chickens. Microorganisms, 12(1), 193.

+ Open protocol

+ Expand

Quantitative PCR Assay for Nucleic Acid Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Each qPCR contained primers at a concentration of 400 nM (80 nM for the MGB probe) and commercially available PCR master mix (TaqMan Universal PCR Master Mix; Thermo Fisher Scientific) containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl₂, 2.5 mM deoxynucleotide triphosphates, 0.625 U AmpliTaq Gold DNA polymerase per reaction, 0.25 U AmpErase uracil N-glycosylase (Applied Biosystems) per reaction and 5 µl diluted sample total nucleic acid (1:5 dilution for blood, 1:1 for urine) in a final volume of 12 µl. The samples, in addition to positive and negative PCR controls, were placed in a 384-well plate. Amplification was performed under the following conditions on a QuantStudio Q7 Pro PCR system (Applied Biosystems): 2 mins at 50°C and 10 mins at 95°C, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Fluorescent signals were collected during the annealing temperature, and the quantitative cycle (Cq) was calculated and exported with a threshold of 0.1 and a baseline of 3–10.

Sebastian J.F., Reagan K.L., Peavy T., Zecca I.B., Hamer S.A, & Sykes J.E. (2023). Evaluation of Leptospira infection and exposure in free-roaming cat populations in northern California and southern Texas. Journal of Feline Medicine and Surgery, 25(3), 1098612X231162471.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!