Dna stool mini kit

After a bead-beating step, total DNA was extracted from 200 mg of feces using the DNA Stool minikit (Qiagen) according to manufacturer recommendations. Bacterial load was assessed by quantitative PCR of the Bacteria domain as previously described^{25 (link)}. The V3–V4 region of the 16S rRNA gene was amplified with the following primers: V3F «TACGGRAGGCAGCAG» (bac339F modified from^{26 (link)}) and V4R «GGACTACCAGGGTATCTAAT» bac806R. 16S rDNA amplicon libraries were sequenced at GENOTOUL (https://www.genotoul.fr) on a MiSeq device using the 2 × 250 bp V3 kit. Remaining adapter/primer sequences were trimmed and reads were checked for quality (≥ 20) and length (≥ 200 bp) using cutadapt²⁷ . Reads were further corrected for known sequencing error using SPAdes^{28 (link)} and then merged using PEAR^{29 (link)}. OTUs were identified using a Vsearch pipeline^{30 (link)} set up to dereplicate (–derep_prefix –minuquesize 2), cluster (–unoise3), chimera check (uchime3_denovo) the merged reads. OTU taxonomical classification was performed using both classifier and seqmatch from RDPTools suit^{31 (link)}. The training sequence data set required for OTU classification at species level was downloaded from EzBioCloud 16S database for QIIME^{32 (link)}. Metagenomic profile inference from 16S dataset was determined using PICRUSt^{33 (link)}.

Metagenomic DNA was extracted from each of the 36 samples from ileum, colon and rectum using DNA Stool Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The V3-V4 region of the bacterial 16S rRNA genes was amplified by PCR, using specific barcode primers 338 F (5′-ACTCCTACGGGAGGCAGCAG-3′) and 806 R (5′-GGACTACHVGGGTWTCTAAT-3′) as described by Bi et al., [25 (link)]. The PCR was carried out by the following protocol: an initial denaturation step at 95 °C for 2 min, followed by 30 cycles at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s and a final extension at 72 °C for 5 min. The PCR products were visualized on 2% agarose gels and were quantitatively determined using QuantiFluor-ST Fluoremeter (Promega, Wisconsin, USA) and PicoGreen dsDNA Quantitation Reagent (Invitrogen, Carlsbad, CA, USA). The PCR amplicons were purified with an AxyPrep DNA Purification kit (Axygen Biosciences, Union City, CA, USA).

DNA extraction of intestinal contents was conducted using the DNA Stool Mini Kit (Qiagen, Hilden, Germany) following manufacturer's protocols. The bacterial universal V3–V4 region of the 16S rRNA gene was amplified using PCR bar-coded primers 338F (5′-ACTCCTACGGGAGGCAGCA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′). PCR was set in 20 μL volume, with 1 × FastPfu buffer, 250 μM dNTP, 1 U FastPfu polymerase, 0.1 μM each of the primer and 10 ng template DNA. PCR was conducted at 95°C for 2 min and 30 cycles of 95°C for 30 s, then annealed at 55°C for 30 s, 72°C for 30 s, and extended at 72°C for 5 min.