The largest database of trusted experimental protocols

Superscript m mlv reverse transcriptase

Manufactured by BioTeke

SuperScript M-MLV reverse transcriptase is an enzyme used for the reverse transcription of RNA into complementary DNA (cDNA). It catalyzes the synthesis of single-stranded cDNA from an RNA template.

Automatically generated - may contain errors

2 protocols using superscript m mlv reverse transcriptase

1

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
TRIpure (RP1001, BioTeke Corporation, China) was used for total RNA or miRNA extraction. Then, total RNA and miRNA were synthesized into cDNA by the SuperScript M-MLV reverse transcriptase (PR6502, BioTeke Corporation) and the miRNA cDNA Synthesis kit (#B532451, Sangon Biotech, Shanghai), respectively. Finally, the qRT-PCR was conducted according to the protocols. GAPDH served as a control. The relative level of the specific mRNAs was analyzed using the 2−ΔΔCT method. The sequences of the primers are listed in Supplementary Table 2.
+ Open protocol
+ Expand
2

Quantification of miR-106a-5p and FOXC1 by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
RT-qPCR was performed as described before [24 (link)]. Briefly, total RNA or miRNA from cultured ESCs and tissues was extracted by TRIpure (RP1001, BioTeke, China). Then, total miRNA was reversed transcribed using the miRNA First Strand cDNA Synthesis kit (#B532451, Sangon, Shanghai). Total RNA was converted into first-strand cDNA using SuperScript M-MLV reverse transcriptase (PR6502, BioTeke) with ExicyclerTM 96 Real-Time Quantitative Thermal Block (BIONEER, Korean). RT-qPCR was used to examine miR-106a-5p and FOXC1 expression using an SYBR Green Master Mix (Solarbio, Beijing). β-actin was served as an internal control. The relative expression of miR-106a-5p and FOXC1 was calculated in a 2−∆∆CT manner. The primer sequences were exhibited as followed: hsa-miR-106a-5p, forward: 5ʹ- AAAAGTGCTTACAGTGCAGGTAG −3ʹ; FOXC1, forward: 5ʹ- ACAGCATCCGCCACAACCTC −3ʹ, reverse: 5ʹ- TGTCCTTCACCGCGTCCTTC −3ʹ; β-actin, forward: 5′- CACTGTGCCCATCTACGAGG-3′, reverse: 5′- TAATGTCACGCACGATTTCC-3′.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!