Oligotex dt30 mrna purification kit

Fluorescence spectra of the probes were measured in DEPC/PBS or in 4XSSC, 0.5 mM EDTA, 10% dextran sulfate, 10% deionized-formamide in Milli-Q water using a cuvette with a 1-cm path length. The excitation wavelength was 514 nm (bandwidths 1.5 nm). Nucleic acids to be hybridized (single stranded DNA, extracted RNA, FBS, etc.) were added directly into the solution containing 0.2–0.5 μM probes in the cuvette and mixed by vortex. Extracted RNA was isolated from chick embryo or adult mouse brain using an RNAqueous Kit (Ambion). An oligotex-dT₃₀ mRNA purification kit (TaKaRa) was used to isolate mRNA from total RNA. After mixing, up to 5 min were allowed for hybridization before measurements were taken. To quantify the fluorescence activation of the probes, fluorescence intensities around the emission peak (520–700 nm) were summed and used to calculate the fluorescence intensity ratio of the probes before and after hybridization.

Total RNA was extracted from cultured cells with the RNeasy Mini Kit and RNase-Free DNase Set (Qiagen, Hilden, Germany), and polyA⁺ mRNA was purified using Oligotex™ -dT30 mRNA Purification Kit (Takara Bio). cDNA was synthesized from 10 ng of mRNA by the extension of oligo dT and random 6 mer primers with the PrimeScript RT reagent kit (Takara Bio). Subsequently, qPCR was performed using the ABI Prism 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA) with EagleTaq Master Mix kits (Roche Molecular Systems, Branchburg, NJ). The primer and probe sets used for the amplification of the pre-S1 2.4-kb mRNA were 5′- aggctcagggcatattgaca − 3′, 5′- gtcttcctgactgccgattg − 3′, and Universal ProbeLibrary Probe #16 (Roche). The expression levels of the target gene were determined by normalization to β-actin by the following primers: 5′- aagtcccttgccatcctaaaa − 3′, 5′- atgctatcacctcccctgtg − 3′.

Total RNA was extracted from tumor tissues using the TRIzol^® Reagent (Thermo Fisher Scientific, Waltham, MA, USA) and mRNA was purified using the Oligotex™-dT30 mRNA Purification Kit (Takara Bio, Kusatsu, Japan). cDNA library was constructed from the mRNA with the cDNA Library Construction Kit (Takara Bio) and then ligated into the EcoRI-XhoI site of λZAP II vector after double digestion with EcoRI and XhoI (Lambda ZAP II Undigested Vector Kit, Gigapack III Gold packaging extracts: Agilent Technologies, Santa Clara, CA, USA). Additionally, human testis cDNA library (Uni-ZAP XR Premade Library) was obtained from Agilent Technologies.

Poly(A)⁺ mRNA was isolated from the total RNA of mock/NDV-infected (12 hpi, MOI = 1) HeLa cells using the Oligotex-dT30 mRNA Purification Kit (TaKaRa) according to manufacturer’s instructions. Purification was repeated twice to yield a pure poly(A)⁺ mRNA fraction. The supernatant after centrifugation was subjected to ethanol precipitation in order to obtain a concentrated poly(A)^- RNA fraction. NDV gRNA was isolated from virus particles propagated in the embryonated chicken eggs, as described above. Allantoic fluid was centrifuged overnight at 15,000 rpm at 4°C, and the pellet was lysed using TRIZOL Reagent (Ambion) followed by isopropanol precipitation. 5’-triphosphate RNA was synthesized in vitro as reported previously [49 (link)]. RNA samples were treated with 1 U of ShortCut RNase III (New England Biolabs), 1 U of RNase-free DNase I recombinant (Roche), and 15 U of Calf Intestine Alkaline Phosphatase (Takara) at 37°C for 30 minutes, or 10 U of Vaccinia Capping Enzyme (New England Biolabs) according to the manufacturer’s instruction. After this treatment, RNA samples were purified by phenol-chloroform extraction and ethanol precipitation. Regarding RNA transfection, 200 ng of each RNA sample was transfected into 1×10⁵ MEFs or 2×10⁵ HeLa cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instruction.

Leaves collected from each group of seedlings were pooled to form the control (CK) sample and four weeks drought (DT) sample for RNA isolation. Total RNA was isolated using a CTAB procedure [77 ]. Tissues of CK and DT samples were separately ground in liquid nitrogen and the powder dispersed in CTAB buffer. After two extractions using chloroform-isoamyl alcohol mix (v/v 24:1), the total RNA was precipitated with LiCl₂. To ensure the quality and concentration, the precipitate was suspended in SSTE buffer (0.5%SDS, 10mM Tris-HCl, 1mM EDTA and 1M NaCl), and extracted twice again with chloroform [20 (link)]. Finally, the RNA was precipitated with 3 M sodium acetate and dissolved in 100 μl diethypyrocarbonate (DEPC)-treated water. For each sample, we conducted three extractions of total RNA. The total RNA yield and purity were measured using a NanoDrop 2000 (Thermo Fisher Scientific). The A260/A280 ratios for both samples ranged from 1.9 to 2.1. The quality and concentration of all RNA samples was examined with an Agilent 2100 Bioanalyzer (Agilent Technologies) which showed no sign of degradation. Finally, mRNA was purified from the total RNA using the Oligotex-dT30 mRNA Purification Kit (Takara, China).

Total RNA was extracted from tails of wild type and mutant tadpoles at stage 48/49 by using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA), and poly(A)⁺ mRNA was isolated by using the Oligotex-dT30 mRNA Purification Kit (Takara Bio, Shiga, Japan). A subtracted cDNA library, enriched for mutant cDNAs, was prepared by using the PCR-Select cDNA Subtraction Kit (Clontech, Mountain View, CA, USA) according to the manufacturer’s protocols. Subtracted cDNA fragments were cloned into the pGEM-T Easy Vector (Promega, Madison, WI, USA) and selected by whole mount in situ hybridization (WISH).

Poly-A⁺ RNA (0.5 μg) purified from total RNA using an Oligotex™ -dT30 mRNA Purification Kit (Takara Bio Inc.) was analyzed as previously described [5 (link)], with some modifications. Briefly, blotted membranes were probed with DIG-labeled RNA probes synthesized using T3 (for Actb) or T7 (for Tet1) RNA polymerase and DIG RNA Labeling Mix (Sigma-Aldrich) supplemented with RNAse inhibitor (recombinant RNasin (Promega)), in DIG Easy Hyb solution (Sigma-Aldrich), according to the manufacturer’s protocol. Detection was performed using CDP-star in the same way as done in Southern blot analysis. The corresponding sequences of probes were as follows: Actb, 112–909; Tet1 exons 8–9, 4518–4764; and Tet1 exons 10–13, 4883–6120.