Total RNA was extracted using TRIzol, and the UCA1, miR-184 and Bcl-2 levels were evaluated using a PrimeScript miRNA RT-PCR Kit (Takara, Dalian, People's Republic of China) in accordance with the manufacturer's protocol. The primer pairs are shown in Table 2 . The relative expression of UCA1 and Bcl-2 was calculated using the 2−ΔΔCt method.
Primescript mirna rt pcr kit
Manufactured by Takara Bio
Sourced in China, Japan
The PrimeScript miRNA RT-PCR Kit is a laboratory tool designed for the reverse transcription and real-time PCR amplification of mature microRNA (miRNA) molecules. The kit provides the necessary reagents and protocols to enable the detection and quantification of miRNA expression levels.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (20 mentions)
Sybr green rt pcr kit, by Takara Bio (7 mentions)
Primescript rt reagent kit, by Takara Bio (4 mentions)
Abi 7500 thermocycler, by Thermo Fisher Scientific (4 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (4 mentions)
Primescript rt master mix kit, by Takara Bio (4 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Sybr green real time pcr master mix, by Takara Bio (3 mentions)
Cf96 real time pcr detection system, by Bio-Rad (3 mentions)
M mlv reverse transcriptase, by Promega (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Abi 7300 plus thermocycler, by Thermo Fisher Scientific (2 mentions)
Rneasy column, by Qiagen (2 mentions)
Trizol, by Takara Bio (2 mentions)
Nanodrop nd 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Power sybr green kit, by Thermo Fisher Scientific (1 mentions)
Taqman reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Triquick reagent, by Solarbio (1 mentions)
Sybr premix ex taq 2 kit, by Takara Bio (1 mentions)
Primerscript rt reagent kit, by Takara Bio (1 mentions)
36 protocols using primescript mirna rt pcr kit
1
Evaluating UCA1, miR-184, and Bcl-2 Levels
2
RT-PCR Analysis of miRNA and mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA), and cDNAs were synthesized using the PrimeScript RT reagent Kit (TaKaRa, Dalian, People’s Republic of China). RT-PCR analyses of mRNA were performed with SYBR Mix (TOYOBO, Shanghai, People’s Republic of China). miRNA expression was quantified using the PrimeScript miRNA RT-PCR kit (TaKaRa), and was normalized with U6 small nuclear RNA. The concentration in each sample was calculated using the 2-ΔΔCt method. The primers were: miR-93, forward: CTAGCCTGCAGGGGTGAGTGGTGGGTCCCTGT; LASS2 forward: GCCTTGCTCTTCCTCATCGTTC, reverse: TGCTTGCCACTGGTCAGGTAGA.
3
Quantitative Analysis of miRNA and mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from tissues and cell lines was extracted with TRIzol reagent (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocols. For miR expression analysis, the PrimeScript® miRNA RT-PCR kit (RR014A; Takara, Dalian, China) was used. Real-time PCR was performed on an ABI 7500 thermocycler (Thermo Fisher Scientific, Inc.). The U6 gene was used as an internal reference. For mRNA expression detection, the TaqMan Reverse Transcription kit (N8080234; Thermo Fisher Scientific, Inc.) was used to convert RNA into complementary DNA, according to the manufacturer's protocol. Subsequently, the Power SYBR Green kit (4368702; Thermo Fisher Scientific, Inc.) was used to perform real-time PCR according to the manufacturer's protocol. GAPDH was used as an endogenous control. The following primers were used: Versican forward, 5′-GTAACCCATGCGCTACATAAAGT-3′ and reverse, 5′-GGCAAAGTAGGCATCGTTGAAA-3′; GAPDH forward, 5′-ACAACTTTGGTATCGTGGAAGG-3′ and reverse, 5′-GCCATCACGCCACAGTTTC-3′. Primers for miR-124 and U6 were purchased from Fulengen Co., Ltd. (Guangzhou, China). The reaction conditions were as follows: 95°C for 10 min, and 40 cycles of 95°C for 15 sec and 60°C for 30 sec. The relative expression was analyzed using the 2−ΔΔCt method (14 (link)).
4
RNA Extraction and Quantification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Triquick Reagent (Solarbio) was applied for RNA segregation. The inverted transcription was conducted using a PrimerScript RT Reagent kit (Takara) or a PrimeScript miRNA RT‐PCR Kit (Takara). Subsequently, a SYBR Premix Ex Taq II kit (Takara) was employed for quantitative real‐time polymerase chain reaction (qRT‐PCR) assay on a PCR system. The primers exhibited in Table 1 were used for PCR amplification. β‐actin and U6 were chosen as the inner contrasts, and the relative RNA expression was computed via the 2‐ΔΔCt strategy.
5
Quantifying miR-200b Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. MicroRNA reverse transcription kit (Thermo Fisher Scientific) was used to convert 10 ng of total RNA into complementary DNA, according to the manufacturer’s instructions. The miRNA expression was determined on ABI 7500 thermocycler (Thermo Fisher Scientific) using PrimeScript® miRNA RT-PCR Kit (Takara, Dalian, People’s Republic of China), in accordance with the manufacturer’s instructions. The polymerase chain reaction (PCR) conditions were 95°C for 10 minutes followed by 40 cycles of denaturation at 95°C for 15 seconds and annealing/elongation step at 60°C for 1 minute. The relative miR-200b expression was normalized to U6. The relative expression was analyzed by the 2−ΔΔCt method.15 (link)
6
Quantifying miR-663b and TUSC2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells by using TRIzol Reagent (Thermo Fisher Scientific, Inc.), which was then converted into cDNA using a Reverse Transcription kit (Thermo Fisher Scientific, Inc.), according to the manufacturer's instruction. The miR-663b levels were examined by real-time RT-PCR using PrimeScript® miRNA RT-PCR kit (Takara Bio, Dalian, China) on ABI 7500 thermocycler (Thermo Fisher Scientific, Inc.). U6 was used as an internal reference. The primers for miR-663b and U6 were purchased from Kangbio (Shenzhen, China). The mRNA expression of TUSC2 was detected by qPCR using the standard SYBR-Green RT-PCR kit (Takara Bio). GAPDH was used as an internal reference. The primer sequences for TUSC2 were forward: 5′-GGAGACAATCGTCACCAAGAAC-3′; reverse: 5′-TCACACCTCATAGAGGATCACAG-3′. The primer sequences for GAPDH were forward: 5′-CTGGGCTACACTGAGCACC-3′; reverse: 5′-AAGTGGTCGTTGAGGGCAATG-3′. The reaction condition was 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 15 sec and annealing/elongation step at 60°C for 30 sec. The relative expression was analyzed by the 2−ΔΔCq method (25 (link)).
7
Quantification of miRNA and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues and cell lines using TRIzol reagent (Thermo Fisher Scientific). RNA was converted into cDNA using RevertAid™ First-Strand cDNA Synthesis Kit (Fermentas, Thermo Fisher Scientific) according to the manufacturer’s instructions. To examine the expression of miR, real-time qPCR was conducted using PrimeScript® miRNA RT-PCR Kit (Takara, Dalian, P.R. China) on an ABI 7300 Plus thermocycler (Thermo Fisher Scientific). To examine the expression of mRNA, real-time qPCR was conducted using the standard SYBR Green RT-PCR Kit (Takara). U6 and GAPDH were used as internal references. The relative expression was analyzed by the 2−ΔΔCt method.
8
Quantitative Analysis of miR and mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells and tissues using TRIzol reagent (Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. For miR expression analysis, RT-qPCR was performed using a PrimeScript® miRNA RT-PCR kit (Takara Biotechnology Co., Ltd., Dalian, China), according to the manufacturer's instructions. U6 small nuclear RNA was used as the internal reference. Primer sequences for miRs and U6 were supplied by Fulgene (Guangzhou, China). For mRNA expression analysis, RT-qPCR was conducted using a standard SYBR-Green RT-PCR kit (Takara Biotechnology Co., Ltd.), in accordance with the manufacturer's instructions. GAPDH was used as the internal reference. The specific primers used were as follows: TGFβR2, forward 5′-AAGATGACCGCTCTGACATCA-3′ and reverse 5′-CTTATAGACCTCAGCAAAGCGAC-3′; and GAPDH, forward 5′-CTGGGCTACACTGAGCACC-3′ and reverse 5′-AAGTGGTCGTTGAGGGCAATG-3′. The reaction conditions were 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 15 sec and annealing/elongation at 60°C for 30 sec. Relative expression was analyzed using the 2−ΔΔCq method (22 (link)). The experiments were repeated three times.
9
Quantification of miRNA and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues and cell lines using TRIzol reagent (Thermo Fisher Scientific, Inc.). For the conversion of RNA into complementary (c)DNA, a RevertAid™ First Strand cDNA Synthesis kit (Fermentas, Vilnius, Lithuania) was used according to the manufacturer's protocol. To determine the expression of miR and mRNA, real-time PCR was performed using a PrimeScript® miRNA RT-PCR kit (Takara, Dalian, China) and a standard SYBR® Green RT-PCR kit (Takara), respectively, and the reaction was performed in a Roche 480 thermocycler (Roche Diagnostics, Basel, Switzerland) according to the manufacturer's protocol. U6 and GAPDH were used as internal references for miR and mRNA, respectively. The relative expression was analyzed using the 2−ΔΔCq method (25 (link)). The primer sequences were as follows: CAV1 forward, 5′-GCGACCCTAAACACCTCAAC-3′ and reverse, 5′-ATGCCGTCAAAACTGTGTGTC-3′; GAPDH forward, 5′-GGAGCGAGATCCCTCCAAAAT-3′ and reverse, 5′-GGCTGTTGTCATACTTCTCATGG-3′; miR-124-3p forward, 5′-CGGGTAGCAGGCTTCTGAGT-3′ and reverse, 5′-AAACCCCTCTCTGTCGGTAGCT-3′; U6 forward, 5′-CTCGCTTCGGCAGCACA-3′ and reverse, 5′-AACGCTTCACGAAYYYGCGT-3′.
10
Quantification of miR-138 and Bag-1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. To detect the expression of miR-138, stem-loop reverse transcription—polymerase chain reaction (RT-PCR) was performed using a PrimeScript miRNA RT-PCR Kit (Takara, Dalian, China) according to the manufacturer’s instructions. Total RNA (500 ng) was reversely transcribed in the presence of a poly-A polymerase with an oligo-dT adaptor. Quantitative real-time PCR (qRT-PCR) was performed with a forward primer in order to determine the mature miR-138 sequence and a universal adaptor reverse primer. In order to detect the expression of Bag-1, 500 ng of total RNA was reversely transcribed into first-strand of cDNA with M-MLV reverse transcriptase (TakaRa, Dalian, China). The sequences of the primers used were as follows: 5′-TGAGAAGCACGACCTTCATGT-3′ (forward) and 5′-GGAACCCCTATGACCTCTTCA-3′ (reverse). The β-actin sequences of the primers were as follows: 5′-CCCAGATCATGTTTGAGACCT-3′ (forward) and 5′-GAGTCCATCACGATGCCAGT-3′ (reverse). qRT-PCR was performed using an Applied Biosystems 7500 real-time PCR system (Applied Biosystems) and either U6 or β-actin was used as an internal control. Relative quantification of miR-138 and Bag-1 expression was calculated using the 2-ΔΔCT method. All experiments were repeated three times.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!