Abi quantstudio 3 system

TRIzol reagent (Invitrogen, USA) was used to isolate total RNA from tissues and cells. The Biospin miRNA Extraction Kit (Bioer Technology, China) was used to extract miRNAs according to the manufacturer’s instructions. Evo M-MLV RT Premix (Accurate Biology, China) and Mir-X™ miRNA First-Strand Synthesis (Takara, USA) were used to synthesise cDNA from total RNA and miRNA, respectively. qRT-PCR was performed using the Premix Pro Taq HS qPCR Kit (Accurate Biology, China) on a LightCycler 480 (Roche, USA) or ABI QuantStudio 3 system (Thermo, USA). GAPDH and U6 were served as internal standard controls. All assays were replicated three times. The primers used for qRT-PCR were purchased from Accurate Biology (China). The sequences of all primers are listed in Supplementary Table 3.

PS and ONL samples were prepared from 2.5-months-old $ro{d}^{\Delta Vhl}$ (N = 6) and control (N = 6) mice using the ReLayS method [43 (link)] as described above. Tissue was lysed by proteinase K (Sigma-Aldrich, 03115879001) treatment at 56 ${}^{\circ }$ C for 45 min with shacking at 300 rpm and RNase A (100 mg/ml; Thermo Fisher Scientific, 12091021) was added to the samples. DNA isolation was performed with QIAamp DNA Blood Mini Kit (Qiagen, 51104) according to manufacturer instructions. DNA from PS and ONL samples was pooled together to obtain DNA samples from photoreceptors. Relative quantification of mtDNA levels was determined by the ratio of the mitochondrial ND1 (mt-Nd1) gene to the nuclear-encoded 18S rRNA gene using real-time PCR. 16 ng DNA was used as template and the genes of interest amplified using the PowerUp SYBR Green Master Mix (ThermoFisher Scientific) in the ABI QuantStudio 3 system (ThermoFisher Scientific) and specific primer pairs: ND1 fwd 5’-3’: CTAGCAGAAACAAACCGGGC and ND1 rev 5’-3’: CCGGCTGCGTATTCTACGTT; 18S rRNA fwd 5’-3’: CGCGGTTCTATTTTGTTGGT and 18S rRNA rev 5’-3’: AGTCGGCATCGTTTATGGTC. Data analysis was carried out using the 2 ${}^{\wedge }$ -ddCt method [98 (link)].

PS and ONL samples were prepared from 2.5-months-old $ro{d}^{\Delta Vhl}$ (N = 6) and control (N = 6) mice using the ReLayS method [43 (link)] as described above. Total RNA was isolated from the tissue on the membrane with an RNA isolation kit (Thermo Fisher PicoPure RNA Isolation Kit, KIT0204) including an on-column DNaseI treatment. cDNA synthesis was carried out with oligo-(d)T primers and M-MLV reverse transcriptase (Promega). For semi-quantitative real-time PCR, 10 ng cDNA was amplified using the PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) and specific primer pairs (Actb fwd 5’-3’: CAACGGCTCCGGCATGTGC and rev 5’-3’: CTCTTGCTCTGGGCCTCG; Vdac1 fwd 5’-3’: CAAGGTCACACTGAACATGG and rev 5’-3’: TCACTTTGGTGGTTTCCGT; Tomm20 fwd 5’-3’: TGCATCTACTTCGACCGCAAA and rev 5’-3’: GTCCACACCCTTCTCGTAGTC; mt-Co2 fwd 5’-3’: CCTCCACTCATGAGCAGTCC and rev 5’-3’: AATAACCCTGGTCGGTTTG; mt-Nd1 fwd 5’-3’: CTAGCAGAAACAAACCGGGC and rev 5’-3’: CCGGCTGCGTATTCTACGTT) in the ABI QuantStudio 3 system (Thermo Fisher Scientific). Actin-beta (Actb) was used as a reference housekeeping gene. Data analysis was carried out using the 2 ${}^{\wedge }$ -ddCt method [98 (link)]. Data were visualized with Prism software (GraphPad) and Mann-Whitney nonparametric test was used to compare $ro{d}^{\Delta Vhl}$ and ctrl mice.