Pegfp n1 vector

The cDNA sequences encoding ATP5B or DRP1 were amplified by PCR using the oligonucleotide primers (Genomics, Hsinchu, Taiwan). The amplified fragments were cloned into a pPAGFP-N1 vector (RRID: Addgene_11909) or pCMV-HA-N vector (Clontech Cat# 635690), respectively. MOM-GFP plasmid containing mitochondrial targeting sequence of Tom70 fused to pEGFP-N1 vector was a gift from Josef Kittler (RRID: Addgene_127633)^{95 (link)}. Mitochondrial targeting sequence from subunit VIII of human cytochrome C oxidase was amplified from DsRed2-Mito-7, a gift from Michael Davidson (RRID: Addgene_55838) by PCR, and cloned into pEGFP-N1 vector backbone to be Mito-GFP plasmid. All clones were verified by sequencing (Genomics). The Escherichia coli DH5α strain was used as the competent cell for the transformation of these constructs. The QIAGEN Plasmid Midi Kit (QIAGEN Cat#12143) was used for the purification of plasmids, and the concentration of the purified plasmids was determined using the NanoDrop ND-1000 (NanoDrop Technologies, Montchanin, DE). Plasmids were transfected into cells using jetPRIME (Polyplus-transfection Cat#114-15) according to the instructions provided by the manufacturer, and the transfected cells were incubated for at least 24 h before further experiments.

CD63 cDNA was amplified and cloned into the pEGFP‐N1 vector (Addgene, MA, USA) as described previously (Ye et al., 2020). Then, plasmid for CD63‐EGFP expression was transfected into cells. After 24 h, exosomes were isolated from the conditioned medium and intravenously administered to mice.

To quantify miR-30b-5p expression, total RNA enriched with small RNA was extracted using the mirVana™ miRNA Isolation Kit (Thermo Fisher Scientific) and analyzed by RT-qPCR using miRNA TaqMan® probe (Assay ID: 000602, miRbase accession# MI0000441, mature miRNA sequence: UGUAAACAUCCUACACUCAGCU) from Applied Biosystems/Thermo Fisher Scientific). mir-30b-5p mimic (Assay ID: MC10986), miRNA mimic negative control (#4464058), miR-30b-5p inhibitor (Assay ID: MH10986), Mir-30b-5p inhibitor negative control (#4464076) were all purchased from Applied Biosystems/Thermo Fisher Scientific. SMCs were transfected with 80 nM of the indicated mimic, mimic negative control, miRNA inhibitor, or inhibitor negative control using the Neon® transfection system (MPK-5000; Invitrogen, Waltham, MA). SMCs were microporated using the following parameters: pulse voltage: 1,300 V; pulse width: 20 ms; pulse number: 2; the tip type: 10 μl) and then cultured for 24 hr. The transfection efficiency was ∼51% with 2% cell death as determined using the pEGFP-N1 vector (#6081-5; addgene). Transfections with the indicated mimics and inhibitors did not significantly modulate SMC shape, viability, or adherence (trypan blue dye exclusion; data not shown).