DNA methylation of MFRP promoter sequence from the RPE-choroid complexes of rd6 and WT mice was determined by bisulfite sequencing PCR. Two micrograms of purified genomic DNA was bisulfite-converted and purified using EpiTect Bisulfite Kit (Qiagen, Dusseldorf, Germany). Purified bisulfite-converted DNA was amplified by the designed primer set (Table S1 ) using Epi Taq (Takara, Osaka, Japan) and purified PCR products were cloned into pMD18-T vectors (Takara, Osaka, Japan). Afterward, colonies were selected and sequenced by Sanger sequencing.
Epitaq
Manufactured by Takara Bio
Sourced in Japan
EpiTaq is a DNA polymerase enzyme used in polymerase chain reaction (PCR) amplification of DNA sequences. It exhibits high fidelity and processivity, making it suitable for applications that require accurate DNA replication.
Automatically generated - may contain errors
Lab products found in correlation
Pmd18 t vector, by Takara Bio (1 mentions)
Epitect bisulfite kit, by Qiagen (1 mentions)
Iseq 100 system, by Illumina (1 mentions)
Phix control v3, by Illumina (1 mentions)
Ez dna methylation gold kit, by Zymo Research (1 mentions)
Iseq 100 i1 reagent v2 300 cycle kit, by Illumina (1 mentions)
Nebnext ultra 2 q5 master mix, by New England Biolabs (1 mentions)
Topo ta cloning kit for sequencing, by Thermo Fisher Scientific (1 mentions)
Zymo ez dna methylation gold kit, by Zymo Research (1 mentions)
Minelute pcr purification kit, by Qiagen (1 mentions)
Kapa ltp library preparation kit, by Roche (1 mentions)
Hiseq x platform, by Illumina (1 mentions)
Methylcode bisulfite conversion kit, by Thermo Fisher Scientific (1 mentions)
Seqcap adapter kit a, by Roche (1 mentions)
Picoruptor, by Diagenode (1 mentions)
T blunt vector, by Solgent (1 mentions)
5 protocols using epitaq
1
Methylation Analysis of MFRP Promoter
2
Targeted Bisulfite Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In total, 500 ng of genomic DNA was bisulfite-converted with the EZ DNA Methylation-Gold kit (Zymo Research). Bisulfite PCR was performed using EpiTaq (Takara) using custom-made locus-specific primers containing 4 bp unique molecular identifiers (UMI) on each side of the amplicon and partial adapter sequences to enable library amplification. Primer sequences are listed in Appendix Table S1 . Libraries for sequencing were amplified using unique dual index Illumina adapters and NEBNext Ultra II Q5 Master Mix (NEB). One purification step with Agencourt Ampure XP beads was performed before and after library amplification. Sequencing was performed on the Illumina iSeq 100 System using the iSeq 100 i1 Reagent v2 (300 cycle) Kit. PhiX Control v3 (Illumina) was spiked into the run at a concentration of 30% to improve cluster resolution and enable troubleshooting in the event of a run failure.
3
Bisulfite Sequencing for DNA Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bisulfite sequencing was performed as described previously (Takahashi et al., 2017 (link)). Briefly, bisulfite conversion was carried out using Zymo EZ DNA Methylation-Gold kit (Zymo Research) according to the manufacturer’s protocol, followed by PCR with Epi-Taq (Takara). Amplified fragments were subcloned using TOPO TA Cloning Kit for Sequencing (Thermo Fisher Scientific) and individually sequenced. Obtained sequences were analyzed by QUMA application (http://quma.cdb.riken.jp ).
4
Amplicon-seq of Bisulfite-converted SVA Elements
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was subjected to bisulfite-mediated C to U conversion using the MethylCode Bisulfite Conversion Kit (ThermoFisher Scientific), and then used as a template for PCR for 35 cycles with EpiTaq (Takara) using the following primers: SVA_1_Fw TTATTGTAATTTTTTTGTTTGATTTTTTTGTTTTAG . SVA_1_Rv AAAAAAACTCCTCACATCCCAAAC SVA _2_Fw TTAATGTTGTTTAGGTTGGAGTGTAGTG SVA _2_Rv CAAAAAAACTCCTCACTTCCCAATA . SVA_3_Fw TTTGGGAGGTGTATTTAATAGTTTATTGAGAA SVA_3_Rv TAAACAAAAATCTCTAATTTTCCTAAACAAAAAACC . The PCR products from three sets of primers were combined, purified using a MinElute PCR Purification Kit (QIAGEN), and fragmented using Picoruptor (Diagenode) for 10 cycles of 30 s on and 30 s off. Then, the amplicon-seq library was constructed using KAPA LTP Library Preparation Kits (KAPA BIOSYSTEMS) and SeqCap Adapter Kit A (Roche). The amplicon-seq libraries were sequenced on a HiSeq X platform (Illumina).
5
Bisulfite Sequencing of Oct4 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from the cells of the indicated groups using the Genomic DNA extraction kit (Nanohelix, Korea). Genomic DNA was treated with bisulfite using the Bisulfite conversion system (Promega) according to the manufacturer’s instruction. The converted DNA was amplified by Epitaq (Takara, Japan) using the following primers: Oct4 bisulfite forward primer (5′-GTTTTGGATATGGGTTGAAATATTG-3′) and Oct4 bisulfite reverse primer (5′-CCCCACCTAATAAAAATAAAAAAAC-3′). Then, the PCR products were cloned into T-blunt vector (Solgent, Korea), followed by Sanger sequencing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!