Reaction buffer

Approximately 60 mg of tissue (from the middle of the left gastrocnemius muscle) was homogenized using an Ultra-Turrax homogenizer (IKA, Staufen, Germany) in a solution of TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). Total RNA was isolated using a modified guanidiniumisothiocyanate-CsCl method,26 (link), 27 (link) and the concentration and purity were determined by measuring the absorbance at 260 nm and 280 nm in a spectrophotometer (NanoDrop 2000; Thermo Scientific, Wilmington, MA, USA). Total RNA was reverse transcribed into cDNA using the Revertaid^TM First Strand cDNA Synthesis Kit from Fermentas (Fermentas, Vilnius, Lithuania). cDNA was synthesized using 2 µg of total RNA, 0.2 µg of random primers, 20 mmol/L dNTP mix, 5 × reaction buffer (Fermentas), 20U RiboLock^TM RNase Inhibitor and 200 U of Revertaid^TM M-MuLVreverse transcriptase in a total volume of 20 µL. The reaction was carried out at 25°C for 5 min followed by another 60 min at 42°C and was terminated by the deactivation of the enzyme at 70°C for 5 min. Control reactions lacking either reverse transcriptase or template were included to assess carryover of genomic DNA and non-specific contamination.28 (link), 29 (link)

Following primers were used in the PCR assays, namely, forward primer 5’ TAYCGYAAAGAYTTGAAAGAAG 3’ and reverse primer 5’ CMACACCYTTGTTMCCRTGA 3’[5 (link)] which targets 397 bp region of the rpoB gene of Acinetobacter. The DNA isolated from all the 200 bacterial isolates was subjected to both conventional wet-reagent mix and dry-reagent PCR mix while bacterial cultures in LB broth were tested by dry-reagent PCR mix. A. baumannii (ATCC) was used as reference control in all experiments. Conventional wet-reagent mix consisting of 1X reaction buffer (Fermentas), 2 mM MgCl2 (Fermentas), 0.5 mM each dNTP (Fermentas), 0.5 μM each of forward and reverse primer (Sigma-Aldrich), 1 U of Taq polymerase (Fermentas) was prepared and 2 μl of isolated template DNA was added and the reaction volume was made upto 50 μl using nuclease free water. The amplification was done using QB-96 (Quanta Biotech, UK) thermocycler using the following protocol: initial predenaturation at 95°C for 5 min, 35 cycles of denaturation at 94°C for 45 s, annealing at 53°C for 45 s, and extension at 72°C for 45 s followed by final extension at 72°C for 10 min. Until further processing, the PCR tubes were held at 4°C. The amplicon was subjected to agarose gel electrophoresis (1.5% gel) containing 1 μg/ml ethidium bromide. The gels were examined and photographed by gel documentation system.

The multiplex PCR assay was developed on the basis of previously described three specific PCRs for detection of: Dsp with primers Df (AGAGTCAAAAGCGTCTTG) and Dr (TTTCACCCACCGTCAGTC) (Laurila et al. 2010 ), Pba with primers Y₄₅ (TCACCGGACGCCGAACTGTGGCGT) and Y₄₆ (TCGCCAACGTTCAGCAGAACAAGT) (Frechon et al. 1998 ) and Pcc (together with Pwa) with primers ExpccF (GAACTTCGCACCGCCGACCTTCTA) and ExpccR (GCCGTAATTGCCTACCTGCTTAAG) (Kang et al. 2003 ). Extensive optimisation steps were required to achieve proper functioning of implemented primer pairs in one PCR reaction and finally simultaneous detection of all desired groups of bacteria. The optimisation procedure included establishing the concentration of magnesium chloride (from 2 to 3 mM), reaction buffer (Fermentas, Vilnius, Lithuania) used for amplification (supplemented with 50 mM KCl or with 20 mM NH₄SO₄), the ratio between used primers (from 1:1:1 until the optimised one) and last but not least, the protocol for amplification. It has to be stressed that the use of a well-established positive control for each target group of bacteria in a multiplex assay for each series of tested material is crucial. It excludes any non-specific but similar in size bands that might show during the analysis while testing environmental samples.

Mutant or wild-type HNF1B was overexpressed in the mouse pancreatic β-cell line MIN6. Total RNA was isolated using TRIzol (Invitrogen) according to the manufacturer's instructions. To prepare cDNA, 6 µL of reaction buffer (Invitrogen), 3 µL of 100 mM DTT, 1.5 µL of 10 mM dNTP, 0.6 µL of random primer, 0.3 µL of RNase inhibitor, 1.0 µL of RTase, and 1 µg of RNA were mixed, and RNase-free water was added up to 30 µL. The mixture was incubated 37℃ for 1 h and 72℃ for 10 min using a PCR system. Expression levels of genes were determined by using SYBR Master Mix (Takara, Otsu, Japan) and an AB 7500 Real-time PCR system (Applied Biosystems, Foster City, CA, USA). The primer sequences for the PCR were as follows: 5'-GGC TAA TTT CAG GAC TGG TT-3' and 5'-TTT CTT TGC CCT GAC TTC CT-3' for GLUT2 and 5'-CTC GGC TCA CCG TTT CCT T-3' and 5'-CGC GCT TGC TAA TAG TGC AG-3' for INS. Samples were prepared repetitively, and each sample was analyzed in duplicate. Expression levels of each gene were measured relative to 18S and normalized to the expression levels in total RNA with the ΔΔCT method.