Gateway lr clonase kit

Manufactured by Thermo Fisher Scientific

Sourced in United States

The Gateway LR Clonase kit is a recombination-based system for the transfer of DNA sequences between entry vectors and destination vectors. The kit contains the LR Clonase enzyme mix, which facilitates the recombination reaction.

Automatically generated - may contain errors

Lab products found in correlation

Pmxs ires puro, by Cell Biolabs (2 mentions) Sanger sequencing, by Eurofins (2 mentions) Quikchange 2 xl site directed mutagenesis kit, by Agilent Technologies (2 mentions) Pcag egxxfp, by Addgene (2 mentions) Pcdna3.1 vector, by Thermo Fisher Scientific (2 mentions) Zymogen kits, by Genesee Scientific (2 mentions) Nebuilder hifi cloning master mix, by New England Biolabs (2 mentions) Pdonr223 tie1 plasmid, by Addgene (2 mentions) Plenti cmv blast vector, by Addgene (2 mentions) Pentr4 vector, by Addgene (2 mentions) Px459, by Addgene (2 mentions) Q5 site directed mutagenesis kit, by New England Biolabs (2 mentions) Blasticidin, by Thermo Fisher Scientific (1 mentions) Pcdna3, by Thermo Fisher Scientific (1 mentions) Neuraminidase, by Merck Group (1 mentions) Pcmvr8, by Addgene (1 mentions) Pdonr223 erbb2, by Addgene (1 mentions) Pinducer21, by Addgene (1 mentions) Plv gfp, by Addgene (1 mentions) Plv azurite, by Addgene (1 mentions)

9 protocols using gateway lr clonase kit

Gateway Cloning and Site-Directed Mutagenesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

TNK2 transcript variant 1 in pDONR was purchased from GeneCopoeia (GC-Y4392). Gene mutations were made using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies), and primers were designed using the Agilent Technologies primer design tool. WT and mutated TNK2 were transferred into a Gateway-converted version of pMXs-IRES-Puro (Cell Biolabs Inc.) or MSCV-IRES-GFP using a Gateway LR Clonase kit (Invitrogen). Plasmid sequencing was confirmed via Sanger Sequencing (Eurofins Genomics).
PTPN11 transcript variant 1 in pDONR was purchased from GeneCopoeia (A0360). Gene mutations were made using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies), and primers were designed using the Agilent Technologies primer design tool. WT and mutated PTPN11 were transferred into a Gateway-converted version of p3X-CMV-FLAG14, MSCV-IRES-GFP, or pLenti CMV/TO GFP-Zeo DEST (719-1) (Addgene #17431), or pcDNA 3.2 (Invitrogen) using a Gateway LR Clonase kit (Invitrogen). Plasmid sequencing was confirmed via Sanger Sequencing (Eurofins).

Jenkins C., Luty S.B., Maxson J.E., Eide C.A., Abel M.L., Togiai C., Nemecek E.R., Bottomly D., McWeeney S.K., Wilmot B., Loriaux M., Chang B.H, & Tyner J.W. (2018). Synthetic lethality of TNK2 inhibition in PTPN11-mutant leukemia. Science signaling, 11(539), eaao5617.

+ Open protocol

+ Expand

Generating KRAS, NRAS, MRAS, BRAF, and IDH1 Mutants

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

KRAS, NRAS, MRAS in pENTR/D-TOPO vector (Invitrogen) were used as templates to generate KRAS(G12V), NRAS(Q61K) and MRAS(Q71R) respectively with QuickChange II site-directed mutagenesis kit (Agilent, #200523). To generate doxycycline inducible constructs, the mutants were cloned into the pInducer20 vector (Addgene #44012) using Gateway LR Clonase kit (Thermo Fisher, #11791019). sgRNA targeting SHOC2 (guide1: 5’- TCATACCTATAGTATCTGGG-3’; guide2: 5’- TAGTTATACGATTAAAGCGA-3’) were cloned into lentiCRISPRv2 plasmid (Addgene plasmid #52961) via the BsmBI site. BRAF in pDOR223 (addgene #81684) were used as template to generate BRAF(G596R) with mutagenesis kit (Agilent, #200523). pDOR223-IDH1(L302C) (Addgene #81726), together with pDOR223-BRAF(G569R) were subcloned into pLX304 vector (Addgene plasmid #25890) with Gateway LR Clonase kit (Thermo Fisher, #11791019). H358 STK11 KO and H358 KEAP1-KO cell lines were established and validated in a previous study^{19 (link)}.

Zhao Y., Murciano-Goroff Y.R., Xue J.Y., Ang A., Lucas J., Mai T.T., Da Cruz Paula A.F., Saiki A., Mohn D., Achanta P., Sisk A.E., Arora K.S., Roy R.S., Kim D., Li C., Lim L.P., Li M., Bahr A., Loomis B.R., de Stanchina E., Reis-Filho J., Weigelt B., Berger M., Riely G., Arbour K.C., Russell Lipford J., Li B.T, & Lito P. (2021). Diverse alterations associated with resistance to KRAS(G12C) inhibition. Nature, 599(7886), 679-683.

+ Open protocol

+ Expand

Socs3 Lentiviral Vector Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse Socs3 cDNA was inserted into plentiCMV/TO (775-1) with CMV promoter using a Gateway LR clonase kit (Invitrogen) according to the manufacturer’s instruction, and sequences were confirmed by sequencing at the Boston Children’s Hospital Intellectual and Developmental Disabilities Research Center Molecular Genetics Core Facility. Socs3-carrying lentiviruses were produced as follows. In brief, Lenti-Socs3 or lenti-control, REV, VSVG, and pMDL (gas-pol) packaging plasmids were mixed with polyethylenimine and transfected into HEK293T cells (cat. no. HCL4517; Thermo Fisher Scientific). 72 h after transfection, the cell medium was harvested, and cellular debris was removed by centrifugation at 1,500 rpm before filtration over a 0.22-µm low-protein binding filter. Then, the filtered medium was centrifuged using a SW28 rotor (37 ml) for 2 h at 19,500 rpm (50,000 g) at 4°C. The supernatant was removed, and 100 ml PBS was added to the pellet and transferred to a new tube after 5–10 min. The virus was aliquotted and stored at −80°C.

Sun Y., Lin Z., Liu C.H., Gong Y., Liegl R., Fredrick T.W., Meng S.S., Burnim S.B., Wang Z., Akula J.D., Pu W.T., Chen J, & Smith L.E. (2017). Inflammatory signals from photoreceptor modulate pathological retinal angiogenesis via c-Fos. The Journal of Experimental Medicine, 214(6), 1753-1767.

+ Open protocol

+ Expand

HER2 Overexpression Plasmid Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols

We cloned the 3768‐bp HER2 fragment from a previously synthesised GV219 vector in the laboratory²⁸ and inserted it into the pDONOR223 vector backbone using the gateway BP Clonase Kit (Invitrogen, #11789100). Hereafter, the construct was displaced and attached to the pDEST vector backbone by the gateway LR Clonase Kit (Invitrogen, #11791100). After Sanger sequencing, the HER2 overexpression plasmid and the envelope VSV‐G and gag‐pol packaging plasmids were introduced into 293T cells to generate retrovirus particles. MCF‐10CA1a cells were infected with virus for 2 days, after which cells were selected with 10 μg/ml blasticidin (Gibco, #A113903) for 5 days.

Guo L., Li X., Yang Y., Lu X., Han X., Lang G., Chen L., Shao Z, & Hu X. (2021). Large‐scale genomic sequencing reveals adaptive opportunity of targeting mutated‐PI3Kα in early and advanced HER2‐positive breast cancer. Clinical and Translational Medicine, 11(11), e589.

+ Open protocol

+ Expand

Mutagenesis of TNK2 Protein Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

TNK2 transcript variant 1 in pDONR was purchased from Genecopoeia (GC-Y4392). TNK2 mutations were made using the QuikChange II XL site-directed mutagenesis kit (Agilent Technologies) and the following primers: TNK2-D163E-F gcctgaagcccgaggtcctgagccagc, TNK2-D163E-R gctggctcaggacctcgggcttcaggc, TNK2-R806Q-F cgctgccaccccagctctcaagctc, TNK2-R806Q-R gagcttgagagctggggtggcagcg, TNK2-P494fs-F gctcaggaggtcggggggtccatg, TNK2-P494fs-R catggaccccccgacctcctgagc, TNK2-P632fs-F ctgcccccccccgcccgcctatg, TNK2-P632fs-R cataggcgggcgggggggggcag, TNK2-S808*-F cccaggtgagctttagagccggggtgg, TNK2-S808*-R ccaccccggctctaaagctcacctggg, TNK2-Q831fs-F gcctggatcacctgggggtggcgtac, TNK2-Q831fs-R gtacgccacccccaggtgatccaggc. Wild type and mutated TNK2 were transferred into a Gateway converted version of pMXs-IRES-Puro (Cell Biolabs, Inc.) or MSCV-IRES-GFP using Gateway LR Clonase kit (Invitrogen). Plasmid sequences were confirmed via Sanger sequencing (Eurofins).

Maxson J.E., Abel M.L., Wang J., Deng X., Reckel S., Luty S.B., Sun H., Gorenstein J., Hughes S., Bottomly D., Wilmot B., McWeeney S.K., Radich J., Hantschel O., Middleton R.E., Gray N.S., Druker B.J, & Tyner J.W. (2015). Identification and characterization of Tyrosine Kinase Non-receptor 2 mutations in leukemia through integration of kinase inhibitor screening and genomic analysis. Cancer research, 76(1), 127-138.

+ Open protocol

+ Expand

Engineered HER2 Expression in Primary Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

An inducible HER2 expression vector was constructed by subcloning the ERBB2 open reading frame from pDONR223-ERBB2 (23888; Addgene, Cambridge, MA, USA) into pINDUCER21 (46948; Addgene) using the Gateway LR Clonase kit (Thermo Fisher Scientific) following the manufacturer’s guidelines. Lentiviral particles were generated by co-transfecting HEK293T cells with the packaging plasmids pMD2.G (12259; Addgene) and pCMVR8.2 (12263; Addgene) and either pLV-GFP (36083; Addgene), pLV-Azurite (36086; Addgene) or pINDUCER21-ERBB2 using FuGENE HD transfection reagent (Promega, Madison, WI, USA) following the manufacturer’s guidelines. Virus-containing supernatant was collected 48 h post-transfection.
When primary myoepithelial and luminal cells were infected with lentiviral particles, particles were treated with 20 mU/ml neuraminidase (Sigma-Aldrich) at 37 °C for 30 minutes prior to their addition to cells. Particles provided with SMARTchoice promoter selection plates (GE Dharmacon, Lafayette, CO, USA) were also treated with 20 mU/ml neuraminidase prior to their application to cells; fluorescence intensity values were acquired using a FLUOstar Omega fluorescent plate reader (BMG Labtech, Cary, NC, USA).

Carter E.P., Gopsill J.A., Gomm J.J., Jones J.L, & Grose R.P. (2017). A 3D in vitro model of the human breast duct: a method to unravel myoepithelial-luminal interactions in the progression of breast cancer. Breast Cancer Research : BCR, 19, 50.

+ Open protocol

+ Expand

Recombinant Tie1 Extracellular Domain Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

All miniprep, maxiprep, and gel extraction steps were conducted using Zymogen kits (Genesee Scientific). Cloning was performed using the NEBuilder HiFi Cloning Master Mix (New England Biolabs) unless otherwise noted. Human Tie1 cDNA was obtained from pDONR223-TIE1 plasmid (23946, Addgene). The Tie1 extracellular domain excluding the native secretion signal (A21 to Q759) was cloned into a pcDNA3.1 vector (ThermoFisher Scientific) containing an N-terminal Ig κ-leader sequence and C-terminal human IgG₁ Fc and 6xHis tags. Truncation (Tie1-N: A21 to S431) and site mutation (Tie1-2A, Tie1-6A) constructs were generated using the Q5 site-directed mutagenesis kit (New England Biolabs). The transmembrane HTP construct was produced as previously described.^{35 (link)} To obtain the lentiviral construct, the HTP sequence was first cloned into the pENTR4 vector (17424, Addgene) and then transferred into the pLenti-CMV-Blast vector (17451, Addgene) using the Gateway LR Clonase kit (ThermoFisher Scientific). The vectors pCAG-EGxxFP (50716, Addgene) and pX459 (62988, Addgene) were used to test gRNA sequences.

Griffin M.E., Sorum A.W., Miller G.M., Goddard WA I.I.I, & Hsieh-Wilson L.C. (2020). Sulfated glycans engage the Ang/Tie pathway to regulate vascular development. Nature chemical biology, 17(2), 178-186.

+ Open protocol

+ Expand

Live-Imaging of Nodes of Ranvier

Check if the same lab product or an alternative is used in the 5 most similar protocols

For live-imaging ex vivo, nodes of Ranvier were detected using β1Na_vmCherry expressed under the control of the Synapsin promoter. Briefly, the pEntr-β1Na_vmCherry plasmid was recombined with the pDestSynAS (generated by Philippe Ravassard, ICM), using the Gateway LR clonase kit from Thermo Fisher Scientific³⁷; detailed description on demand) and the corresponding lentivirus produced by the ICM vectorology plateform. Transduction was performed immediately following slice generation by addition of the lentiviral solution directly onto the slices placed on Milicell membranes (1 μl/slice at a final concentration of ≈10⁹ VP/μl).

Ronzano R., Roux T., Thetiot M., Aigrot M.S., Richard L., Lejeune F.X., Mazuir E., Vallat J.M., Lubetzki C, & Desmazières A. (2021). Microglia-neuron interaction at nodes of Ranvier depends on neuronal activity through potassium release and contributes to remyelination. Nature Communications, 12, 5219.

+ Open protocol

+ Expand

Recombinant Tie1 Extracellular Domain Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!