The largest database of trusted experimental protocols

Fast red

Manufactured by Abcam

Fast Red is a precipitating substrate that produces a red/pink colored reaction product when cleaved by alkaline phosphatase. It is commonly used in immunohistochemistry and in situ hybridization protocols.

Automatically generated - may contain errors

2 protocols using fast red

1

In Situ Hybridization of Avian Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
In situ hybridization experiments were performed as previously described (53 (link)). Antisense riboprobes were synthesized from linearized plasmids containing fragments of T. guttata coding sequences for candidate genes (primer sequences are provided in table S3). The Tbx5 probe was a gift from J. Gros (Pasteur Institute). Double in situ hybridizations were performed using riboprobes tagged with digoxigenin (DIG) or fluorescein RNA-labeling mix (Roche) and sequentially revealed using anti-DIG and anti-fluorescein alkaline phosphatase antibodies (Roche), followed by reaction on bromochloroindolyl phosphate–nitro blue tetrazolium (Promega) and Fast Red (Abcam) substrates.
+ Open protocol
+ Expand
2

Agouti and β-Catenin Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
In situ hybridization experiments were performed as described (24) using antisense riboprobes synthesized from vectors containing a 269-bp fragment of C. japonica, A. rufa, or S. reevesii's coding sequences for agouti, or an 881-bp fragment of C. japonica's coding sequence for b-catenin. For double in situ hybridizations, riboprobes were labeled with digoxigenin or fluorescein and sequentially revealed with anti-digoxigenin-AP or anti-fluorescein-AP antibodies (both 1:2000, Roche) and NBT/BCIP (Promega) or fast-red (Abcam) substrates.
Primers: agouti-F: TGCTCTGCTACAGTTTGCT-CAG; agouti-R: TGGTTTGCAGGTTTTGAA); b-catenin-F: AGCTGACTTGATGGAGTTGGA; b-catenin-R: TCGTGATGGCCAAGAATTTC).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!