The RPE cells with 10 µmol/l 7-MX for 0, 24, 48, and 72 h were harvested and washed with PBS. Total RNA was isolated with TRIzol (Invitrogen Inc.), according to the manufacturer’s instructions. The quality and quantity of total RNA were estimated spectrophotometrically. Subsequently, RNA was reverse-transcribed into cDNA using a RevertAid First Strand cDNA synthesis kit (Fermentas, Burlington, Canada). Quantitative PCR (qPCR) was performed as described in a previous study [21 (link)]. Reactions were incubated at 50 °C for 2 min and 95 °C for 10 min, followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C. The primers and probes for A1R (Rn00567668_m1), A2aR (Rn00583935_m1), A2bR (Rn00567697_m1), and GAPDH (Rn01775763_g1) were obtained from Applied Biosystems (Grand Island, NY). The amplification was performed in an ABI 7500 Fast Real-Time PCR system (Applied Biosystems). The 2-ΔΔ Ct method was used for relative quantification of the gene expression.
Rn01775763 g1
Manufactured by Thermo Fisher Scientific
Sourced in Japan, United States
The Rn01775763_g1 is a laboratory equipment product manufactured by Thermo Fisher Scientific. It is designed to perform a specific core function within a laboratory setting. No further details about its intended use or capabilities are provided, as a concise and unbiased description is required.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (2 mentions)
Abi 7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Stepone software program, by Thermo Fisher Scientific (1 mentions)
Rn00562126 m1, by Thermo Fisher Scientific (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Taqman rna to ct 1 step kit, by Thermo Fisher Scientific (1 mentions)
Ultraglutammine media, by Lonza (1 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Steponeplus real time pcr, by Thermo Fisher Scientific (1 mentions)
Taqman fast advanced master mix, by Thermo Fisher Scientific (1 mentions)
Taqman probe, by Thermo Fisher Scientific (1 mentions)
Lightcycler 1.5 real time pcr system, by Roche (1 mentions)
Taqman assay, by Thermo Fisher Scientific (1 mentions)
7300 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Trisure reagent, by Meridian Bioscience (1 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
8 protocols using rn01775763 g1
1
Quantitative Analysis of Adenosine Receptor Expression
2
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After 30 minutes, 1 hour or 6 hours of stimulation by the indicated peptide/hormone (10−7 or 10−9 M of ANP, 10−7 M of isoproterenol, or 0.5 µM of CL316,243), each dish was snap frozen. Where indicated, 20 µM of SB203580 or equivalent volume of DMSO was added to the medium. Total RNA was extracted from the frozen cells using TRIzol reagent (Invitrogen) and a quantitative real-time PCR was performed using a StepOnePlus Real-time PCR System and the StepOne Software program (Applied Biosystems), as described previously37 (link). The real-time PCR protocol consisted of one cycle at 95 °C for 20 s followed by 40 cycles at 95 °C for 1 s and 60 °C for 20 s using the primers for UCP1 (Applied Biosystems, Rn00562126_m1) and GAPDH (Applied Biosystems, Rn01775763_g1). The transcriptional levels were determined using the ∆∆Ct method with normalization to GAPDH.
3
Quantification of OXR1 and V1aR mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fragments of the medulla oblongata homogenized and the RNA were obtained as described earlier [14 (link)]. RT-PCR analysis was performed with the TaqMan® RNA-to-Ct™ 1-Step Kit and the starter for the following gene: rat OXR1 (Hcrtr1, Rn00565032_m1; Life Technologies); rat V1aR (Avpr1a, Rn00583910_m1; Life Technologies) tagged with a FAM pigment, a starter for the rat GADPH (Rn01775763_g1; Life Technologies) tagged with a VIC pigment. The RT-PCR analysis was performed as described previously [12 (link),14 (link)], using a ViiA™ 7 Real-Time PCR System thermocycler (Life Technologies). The comparative gene expressions are shown as ΔCt in arbitrary units.
4
Nogo-A Modulation of Neuronal Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PC-12 cells were seeded at 8 × 105 cells/600 mm2 into a 100-mm BD-Biocoat dish (Corning, NY, USA) and grown overnight in Roswell Park Memorial Institute (RPMI) 1640 with UltraGlutammine media (LONZA) supplemented with 10% FBS, 5% HS, and 1% P/S. After 24 h, cells were treated with 100 ng/mL NGF. On day 3, cells were treated for 2 h with 1, 3, and 12 µg/mL of anti-Nogo-A. Following this treatment, cells were treated with 1000 ng/mL of the recombinant Nogo-A peptide.
Total RNA extraction was performed using TRIzol® (Life Technologies, Carlsbad, CA, USA). RNA retro-transcription was performed using SuperScript® II Reverse Transcriptase (Life Technologies, Carlsbad, CA, USA). Neuron growth-associated protein 43 (GAP43) and neurofilament light (NFL) gene expression analysis was performed using StepOnePlus™ Real-Time PCR (Applied Biosystems®, Foster City, CA, USA) and TaqMan® Fast Advanced Master Mix (Life Technologies). The rat probes used for this analysis were Rn01474579_m1 (GAP43) and Rn00582365_m1 (NFL; Life Technologies); glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was used as expression housekeeping control (Rn01775763_g1; Life Technologies).
Total RNA extraction was performed using TRIzol® (Life Technologies, Carlsbad, CA, USA). RNA retro-transcription was performed using SuperScript® II Reverse Transcriptase (Life Technologies, Carlsbad, CA, USA). Neuron growth-associated protein 43 (GAP43) and neurofilament light (NFL) gene expression analysis was performed using StepOnePlus™ Real-Time PCR (Applied Biosystems®, Foster City, CA, USA) and TaqMan® Fast Advanced Master Mix (Life Technologies). The rat probes used for this analysis were Rn01474579_m1 (GAP43) and Rn00582365_m1 (NFL; Life Technologies); glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was used as expression housekeeping control (Rn01775763_g1; Life Technologies).
5
Quantifying IGF2 Expression in Dorsal Horn
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To confirm gene expression in response to PRF treatment, 1 μg of total RNA from the left L4–L6 dorsal horns were converted to single-stranded cDNA with the application of an ABI Reverse Transcriptase kit (Life Technologies).The mRNA expression of IGF2 was validated by quantitative real-time PCR (qPCR) through a universal probe library system (forward primer, CGCTTCAGTTTGTCTGTTCG; reverse primer, GCAGCACTCTTCCACGATG; UPL probe No. 40; Roche Diagnostics, Mannheim, Germany) in a LightCycler 1.5 Real-Time PCR system (Roche Applied Sciences, Mannheim, Germany). The RLs of target mRNA in various samples were normalized to that of glyceraldehyde 3-phosphate dehydrogenase (GAPDH, NM_017008) through a TaqMan probe-based gene expression analysis system (Rn01775763_g1; Life Technologies).
6
Renal Cortex RNA Extraction and Renin mRNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the renal cortex tissue of the frozen kidney using Trizol™reagent (Thermo Fisher Scientific, Tokyo, Japan) and chloroform-isopropanol with phase-separation by centrifugation. The concentration of total RNA obtained was determined by the absorbance at 260 nm using an Ultra-micro spectrophotometer NanoDrop™ 1000 (Thermo Fisher Scientific). Two μg of total RNA was reverse-transcribed to cDNA using a High Capacity RNA-to cDNA™ kit (Thermo Fisher Scientific). The cDNA obtained was diluted (1:2) and used with EagleTaq universal MMX™ (Roche Diagnostics, Tokyo, Japan) and a probe/primer kit, TaqMan Assay™, specific for rat renin (Rn00561847_m1, Thermo Fisher Scientific) or for rat-glyceraldehyde-3-phosphate dehydrogenase (Rn01775763_g1, Thermo Fisher Scientific). Real-time PCR was performed using a 7300 Real-Time PCR System (Applied Biosystems-Thermo Fisher Scientific, Tokyo, Japan) programmed as follows: a 10-min holding period at 95 °C, followed by 40-cycle amplification for 15 s at 95 °C, and 1-min at 60 °C. Expression values were calculated according to the ΔΔCT method. The expression of mRNA for renin relative to that for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was compared between sexes and the 2 diets.
7
Amylin Receptor Gene Expression in Alcohol-Exposed Rats
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following 12 weeks of intermittent access to alcohol, rats were decapitated and the brains were removed and immediately placed on a cold glass plate. The NAc, VTA, amygdala, hippocampus, prefrontal cortex, and striatum were rapidly dissected, transferred into a plastic tube and stored in −80 °C until further analysis. Real-time qPCR was performed to identify the expression levels of the main components of the amylin receptor CALCR, RAMP1, and RAMP3 (genes of interest, GOI). In this experiment the selected reference gene (RG) was GAPDH. The TaqMan® Gene Expression Essays used for screening in these experiments were as follows: Rn01427056_m1 (RAMP1 rat), Rn00571815_m1 (RAMP3 rat), Rn00587525_m1 (CALCR rat), and Rn01775763_g1 (GAPDH rat) (Thermo Fisher Scientific, Waltham, MA, USA).
8
Quantitative RT-PCR Analysis of Cardiac Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from heart samples using TRIsureTM reagent (BIOLINE, UK) following the manufacturer's protocol. Quantitative RT-PCR was performed using Taqman universal PCR master mix (Applied Biosystems, USA). The amplification program consisted of 50 °C for 2 min, 95 °C for 10 min and 40 cycles of 95 °C for 15 s and 60 °C for 1 min and was performed in a 7900HT Fast Real-Time PCR System (Applied Biosystems, USA). Primers used for ANP, BNP, calpain-1, calpain-2, calpastatin, Myh6, Myh7 and GADPH were purchased from Thermofisher (Rn00561661_m1, Rn04219558_g1, Rn00569689_ m1, Rn00567422_m1, Rn00583952_m1, Rn00691721_g1, Rn01488777_g1 and Rn01775763_g1, respectively). For GRK2 self-designed probes were purchased from Sigma labeled with Syber Green (Table 1) and POWER SYBR Green PCR Master Mix (Applied Biosystems, USA) was used with an amplification program consisting in 94 °C for 3 min, 40 cycles of 94 °C for 45 s, 55 °C for 30 s, 72 °C for 1 min and 72 °C for 10 min.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!