α gfp

Detailed western blotting procedures are described in supplemental methods. The following primary antibodies were used in this work: α-GFP, Abcam, Cambridge, UK, ab32146; α-GAPDH, Sigma-Aldrich, Darmstadt, Germany, MAB374m; α-HSP70, Invitrogen, MA3-006; α-HSP90, Protein Tech, Rosemont, IL, USA, 13171–1-AP; α-Phospho-eIF2α Ser52, ThermoFisher Scientific, 44–728G; α-eIF2α, ThermoFisher Scientific, AHO0802; α-eEF2, Cell Signaling Technology, Danvers, MA, USA, 2332; α-Phospho-eEF2 (Thr56), Cell Signaling Technology, 2331.

ChIP was performed as described in ref. 49 (link). ChIP was performed with antibodies: α-H3 (Abcam, ab1791), α-H3K36me3 (Abcam, ab9050), α-H3K27me3 (Abcam, ab192985), α-H3K27me2 (Upstate, 07-452), α-H2AK119ub (Cell Signaling Technology, #8240), α-H3K4me1 (Abcam, ab8895), and α-GFP (Abcam, ab290).

All animal experiments were performed according to protocols approved by the animal welfare committee of the Leiden University Medical Center and conform the guidelines from Directive 2010/63/EU of the European Parliament on the protection of animals used for scientific purposes. Female Rosa26^mTmG/mTmG mice were set-up for timed matings with male Wt1^creERT2/+. The presence of a plug in the morning was denoted as embryonic day (E)0.5. At E9.5, the mother was injected with tamoxifen (2 mg) to label the pro-epicardial cells. After three days, when the epicardium has covered the heart, embryos were isolated from which the embryonic heart was dissected and cultured based on a previously published protocol (Jackson-Weaver et al., 2020 (link)). Embryonic tissue was cultured in DMEM high glucose and M199 mixed in a 1:1 ratio supplemented with 0.1% FBS and 100 U/mL penicillin and 100 mg/ml streptomycin at 37°C in 5% CO₂. After 24 h, the culture medium of the embryos carrying the Cre + genotype was supplemented with 2 ng/ml FGF with or without 200 ng/ml Activin A and incubated for another 48 h. The tissue was fixed in 4% PFA, embedded in paraffin, sectioned, and stained as described (Kruithof et al., 2020 (link)) using the following antibodies: α-GFP(Abcam, ab13970), α-Tropomyosin (Sigma-Aldrich, T9283) and α-Wt1 (Abcam, ab89901).

Antibodies used were as follows: α-GFP (Abcam #ab290, Cambridge, UK), α-GFP Sepharose (Abcam #ab69314), α-PRMT3 (GeneTex #GTX23765, Irvine, CA, USA), α-asymmetrical dimethyl arginine (α-ADMA) (Cell Signaling Technology #13522, Denvor, MA, USA), α-GAPDH (GeneTex #GTX100118), α-Flag (Sigma, #F1804, St Louis, MO, USA), and α-Actin (Millipore #MAB1501, Birlington, MA, USA). Chemicals were as follows: SGC707 (Cayman #17017, Ann Arbor, MI, USA), cycloheximide (Sigma #C7698), heptelidic acid (BioVision #2215-250, Milpitas, CA, USA), and oligomycin A (Cayman #11342). Plasmids were as follows: The pEGFP-PRMT3 expression vector was kindly provided by Dr. Mien-Chie Hung [20 (link)]. pcDNA3-PRMT3 expression vector was a gift from Dr. Jian Jin. Human GAPDH cDNA ORF Clone was purchased from Sino Biological (#HG10094-NF, Beijing, China). R248K-GAPDH mutant was generated using a QuickChange site-directed mutagenesis kit according to the manufacturer’s protocol (Agilent Technologies #200519, Santa Clara, CA, USA). The primers used for mutagenesis are shown as follows (5´–3´):

F: GTGGTGGACCTGACCTGCAAGCTAGAAAAACCTGCC

R: GGCAGGTTTTTCTAGCTTGCAGGTCAGGTCCACCAC

GORK distribution between plasma membrane and endomembrane fractions was determined by aqueous two-phase partitioning. Arabidopsis leaf tissues were infiltrated in either 100 mm KCl or 0.1 mm KCl buffers and incubated for 2 h. All subsequent steps were carried out at 4°C as described before (Honsbein et al., 2009 (link)). Proteins were separated by electrophoresis and transferred onto PVDF membranes (Honsbein et al., 2009 (link); Karnik et al., 2013 (link)) and were probed overnight with primary antibody, either αGORK [1:100]; αAHA [1:5000, (Villalba et al., 1991 (link))], αSec61 [1:3000, (Yuasa et al., 2005 (link))], or αGFP [1:200; Abcam, http://www.abcam.co.uk]. Horseradish peroxidase-coupled, α-rabbit IgG secondary antibody (1:100 000) was used for detection with WestFemto SuperSignal (Pierce; Thermo Scientific, http://www.thermofischer.com). In some experiments, membranes were re-probed after stripping by incubation in 100 mm β-Mercaptoethanol, 2% SDS, 62.5 mm Tris-HCl, pH 6.7 at 70°C for 45 min.

Primary antibodies used in these experiments were α-Tubulin (Sigma-Aldrich, T5168; Abcam, ab6046 and ab4074), α-A3B (5210-87-13, custom^{68 (link)}), α-Flag (Sigma-Aldrich, F1804), α-Topoisomerase I (Abcam, ab109374), α-Lamin B1 (Abcam, ab16048), α-IgG2a (Sigma-Aldrich, M5409), α-HA (Cell Signaling Technology, 3724S), α-GFP (Abcam, ab290, Lot GR3251545 and GR3270983 for ChIP), α-mCherry (Abcam, ab167453) α-HNRNPUL1 (gift from S. Wilson, University of Sheffield, UK), α-rabbit IgG Isotype Control (Invitrogen, 02-6102, lot RI238244), α-RNA/DNA Hybrid S9.6 (Kerafast, ENH001 or obtained in house from a hybridoma cell line^{69 (link),70 (link)}), α-dsDNA (Abcam, ab27156) and α-gamma-H2AX (Novus, NB100-384). Secondary antibodies used were α-rabbit IRdye 800CW (LI-COR, 827-08365), α-mouse IRdye 680LT (LI-COR, 925-68020), α-rabbit HRP (Cell Signaling Technology, 7074P2 or Sigma-Aldrich, A0545) and α-mouse HRP (Cell Signaling Technology, 7076P2 or Sigma-Aldrich, A8924), Alexa Fluor 488 goat anti-mouse IgG (Invitrogen, A-11029), Alexa Fluor 594 goat anti-mouse IgG (Invitrogen, A-11032), Alexa Fluor 488 goat anti-rabbit IgG (Invitrogen, A-11034), Alexa Fluor 647 goat anti-mouse IgG (Invitrogen, A-21236) and Alexa Fluor 594 goat anti-rabbit IgG (Invitrogen, A-11037).