T7 endonuclease 1 kit

All of the oligonucleotide sequences are shown in Supplementary Table S1. DNA sequences were obtained from Sangon Biotech (Shanghai, China). RNA oligonucleotides were synthesized by Generay Biotech (Shanghai, China). An sgRNA in vitro transcription kit and SpCas9 and dCas9 proteins were obtained from Inovogen Tech. Co. Ltd (Beijing, China). RNase inhibitor, Dzup genomic DNA isolation reagent, High-Fidelity PCR Master Mix and a SanPrep column polymerase chain reaction (PCR) product purification kit were purchased from Sangon Biotech (Shanghai, China). 4,4′-Dihydroxyazobenzene and 1-(2-chloroethyl) piperidine hydrochloride were obtained from Aladdin Biochemical Tech Co., Ltd (Shanghai, China). Lipofectamine 3000 transfection agent and E-Gel EX agarose gels were purchased from Thermo Fisher Scientific Inc. (MA, USA). The pSLQ1658-dCas9-EGFP plasmid was obtained from Addgene. A T7 endonuclease I kit was purchased from Vazyme (Nanjing, China). The concentration of nucleic acids was quantified using a NanoDrop 2000c (Thermo Scientific, MA, USA).

After being treated with various formulations, the DNA genomes of A375 cells were isolated and harvested with FastPure® Cell/Tissue DNA Isolation Mini Kit (Vazyme). The 2 × Phanta Max Master Mix (Vazyme) was applied to amplify sgNRF2-targeted DNA and sgHSP90α-targeted DNA fragments from genomic DNA of the above-mentioned cells using the following primers: HSP90α GGGCTGTCCAAGTTCATC and CCCACAGCACTTTGTCATATA; NRF2 CCCACTTCCCACCATCAACA and TCTTGGGAAAGTTATGGCAGGT. PCR program [(95 °C) for 3 min, (95 °C for 30 s; 60 °C for 30 s, 72 °C for 30 s) for 35 cycles and (72 °C for 5 min)] was used. Then, we purified the amplified product and used the T7 Endonuclease I Kit (Vazyme) to detect the frequency of indels. The digested DNA was analyzed using 2% agarose gel electrophoresis. Indel formation efficiencies were calculated by Image J.

To determine gene editing efficiency in PLK1 and MHL1 genes, sgRNA targeting PLK1 gene (5′-TACCTACGGCAAATTGTGCT-3′) and MHL1 (5′-TCACCGTGATCAGGGTGCCC-3′) were prepared and complexed with Cas9, respectively. Cells were seeded in 6-well plates at a density of 5 × 10⁴ cells per well and cultured overnight at 37 °C under a humidified atmosphere with 5% CO₂. Next, cells were treated with different formulations for 48 h, and genomic DNA from using a Dzup Genomic DNA Isolation Reagent. The sgRNAs targeting the PLK1 and MHL1 were amplified using the High-Fidelity PCR Master Mix (Sangon Biotech Co., Ltd., Shanghai, China) with the corresponding PCR primers. Indel efficiency was detected using a T7 Endonuclease I kit (Vazyme Biotech Co., Ltd., China), and indel event frequencies were calculated using ImageJ (National Institutes of Health, Bethesda, MD, USA).