The largest database of trusted experimental protocols

Abi quantstudio 7 flex real time detection system

Manufactured by Thermo Fisher Scientific
Sourced in China, United States

The ABI QuantStudio 7 Flex Real-Time Detection System is a laboratory instrument designed for real-time quantitative PCR (qPCR) analysis. It is capable of performing accurate and sensitive detection and quantification of nucleic acid targets.

Automatically generated - may contain errors

2 protocols using abi quantstudio 7 flex real time detection system

1

Circadian Gene Expression Profiling in Avian Uterus

Check if the same lab product or an alternative is used in the 5 most similar protocols
Using the PrimeScript RT Reagent Kit (TaKaRa, Dalian, China) and the manufacturer's instructions, total RNA from the uterine tissues of birds at ZT2, ZT7, ZT12, ZT17, ZT22, and ZT27 (ZT3 in the normal group) was reverse transcribed into cDNA. qRT-PCR was carried out on the ABI QuantStudio 7 Flex Real-Time Detection System (Life Technologies, Carlsbad, CA) using the KAPA SYBR Fast universal qRT-PCR kit (TaKaRa, Dalian, China). Eight genes' relative expression levels were measured using the 2−ΔΔCt method, with GAPDH serving as a reference (Kenneth and Thomas, 2001 (link)). Table 1 lists the primer sequences.

List of primers used.

Table 1
GeneProduct size (bp)PrimerSequence (5′-3′)
CLOCK121FGCTTCCAGGTAATGCTCGGAAG
RCCAGTCCTGTCGAATCTCACTGG
PER2115FCCAACTTTGTTGTGTGCTCCTTGC
RCTGGAACAAACAGGTTGGTGTGTG
CA2151FRCCCATCGCCATCAGCACCAAAGGCAGCACTGACTTGTCGGAGGA
CRY2141FGCACGGCTGGATAAACACT
RAAATAAGCGGCAGGACAAA
FBXL3137FATGTGTGGCGGTCGTCTCTCA
RGTGGGCATCATGTCTGGGAACC
ATP2B1198FCTCTTGCCTTGGCGACAGAACC
RGCAGAGGTGCGTTTCTTCCACT
ITPR2154FAACAGCACCAGCCTCCAGACA
RTCCCACGGTTCTTCGCCACTT
PHLPP1171FGCGGCATGGCTTCAGAGATCA
RGGAAGGAGTTGGACAGGCAGAC
GAPDH153FAGGACCAGGTTGTCTCCTGT
RCCATCAAGTCCACAACACGG
+ Open protocol
+ Expand
2

Quantitative RT-PCR for Pigeon Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA of the same sources and concentrations with library preparation was reverse transcribed into cDNA using PrimeScript RT Reagent Kit (TaKaRa, Japan) following the manufacturer's instruction. Quantitative RT-PCR was performed on ABI QuantStudio 7 Flex Real-time Detection System (Life Technologies Holdings Pte Ltd, USA). Each 10.0 μL PCR mixture contained 5 μL of SYBR Premix Ex Taq™ II, 0.5 μL (10 pM) of each primer, 0.2 μL of ROX Reference Dye II (50 × ), 1.5 μL of cDNA (100 ng), and 2.3 μL of ddH2O. Thermo cycling conditions consisted of an initial denaturing at 95°C for 3 min, for 40 cycles of amplification (95°C for 30 s and 60°C for 34 s), followed by thermal denaturing (95°C for 15 s, 60°C for 60 s, and 95°C for 15 s) to generate melting curves to verify amplification specificity. Pigeon β-Actin was used as an endogenous control. Relative quantifications of genes were calculated by 2−ΔΔCT method. The primers of randomly selected genes and lncRNAs were designed using Prime3 and NCBI Primer-Blast.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!