The shRNA sequences were either designed by the Broad Institute GPP Web Portal or reported previously (50 (link)). The retroviral shRNA library was constructed by inserting the mix of shRNA double-strand fragments with 5′-BamHI and 3′-EcoRI sticky ends into the pSIREN-RetroQ_mCherry retroviral vector, in which the puromycin-resistant gene of pSIREN-RetroQ (Clontech) was replaced by the mCherry sequence from the mCherry-pBAD vector (Addgene).
For the study of Bcl6–shRNA and Zdhhc2-shRNA, Bcl6–shRNA (5′- GATCCGCTGTCAAAGAGAAGGCTTTATTCAAGAGATAAAGCCTTCTCTTTGACAGCTTTTTTGATATCG-3′) was inserted into the retroviral pSIREN-RetroQ_GFP vector, in which the puromycin-resistant gene of pSIREN-RetroQ was replaced by the green fluorescent protein (GFP) gene sequence from the PMKO.1-GFP vector (Addgene), Zdhhc2-shRNA-2 (5′-GATCCGTGACAGATGCCAACTTATAATTCAAGAGATTATAAGTTGGCATCTGTCACTTTTTTGATATCG-3′) and Zdhhc2-shRNA-4 (5′-GATCCGCTACTCCTGCGGGACTAAATTTTCAAGAGAAATTTAGTCCCGCAGGAGTAGCTTTTTTGATATCG-3′) were inserted into the retroviral pSIREN-RetroQ_mCherry vector, and a scramble shRNA (5′- GATCCGTGCGTTGCTAGTACCAACCTATTCAAGAGATAGGTTGGTACTAGCAACGCACTTTTTTGATATCG-3′) was inserted into the retroviral pSIREN-RetroQ_mCherry vector as controls.
For the study of Bcl6–shRNA and Zdhhc2-shRNA, Bcl6–shRNA (5′- GATCCGCTGTCAAAGAGAAGGCTTTATTCAAGAGATAAAGCCTTCTCTTTGACAGCTTTTTTGATATCG-3′) was inserted into the retroviral pSIREN-RetroQ_GFP vector, in which the puromycin-resistant gene of pSIREN-RetroQ was replaced by the green fluorescent protein (GFP) gene sequence from the PMKO.1-GFP vector (Addgene), Zdhhc2-shRNA-2 (5′-GATCCGTGACAGATGCCAACTTATAATTCAAGAGATTATAAGTTGGCATCTGTCACTTTTTTGATATCG-3′) and Zdhhc2-shRNA-4 (5′-GATCCGCTACTCCTGCGGGACTAAATTTTCAAGAGAAATTTAGTCCCGCAGGAGTAGCTTTTTTGATATCG-3′) were inserted into the retroviral pSIREN-RetroQ_mCherry vector, and a scramble shRNA (5′- GATCCGTGCGTTGCTAGTACCAACCTATTCAAGAGATAGGTTGGTACTAGCAACGCACTTTTTTGATATCG-3′) was inserted into the retroviral pSIREN-RetroQ_mCherry vector as controls.