For the study of Bcl6–shRNA and Zdhhc2-shRNA, Bcl6–shRNA (5′- GATCCGCTGTCAAAGAGAAGGCTTTATTCAAGAGATAAAGCCTTCTCTTTGACAGCTTTTTTGATATCG-3′) was inserted into the retroviral pSIREN-RetroQ_GFP vector, in which the puromycin-resistant gene of pSIREN-RetroQ was replaced by the green fluorescent protein (GFP) gene sequence from the PMKO.1-GFP vector (Addgene), Zdhhc2-shRNA-2 (5′-GATCCGTGACAGATGCCAACTTATAATTCAAGAGATTATAAGTTGGCATCTGTCACTTTTTTGATATCG-3′) and Zdhhc2-shRNA-4 (5′-GATCCGCTACTCCTGCGGGACTAAATTTTCAAGAGAAATTTAGTCCCGCAGGAGTAGCTTTTTTGATATCG-3′) were inserted into the retroviral pSIREN-RetroQ_mCherry vector, and a scramble shRNA (5′- GATCCGTGCGTTGCTAGTACCAACCTATTCAAGAGATAGGTTGGTACTAGCAACGCACTTTTTTGATATCG-3′) was inserted into the retroviral pSIREN-RetroQ_mCherry vector as controls.
Psiren retroq
The PSIREN-RetroQ is a retroviral vector that allows for the inducible expression of shRNA. It contains a puromycin resistance gene for selection of transduced cells and a retroviral backbone for stable integration of the shRNA construct into the host genome.
Lab products found in correlation
1 protocol using psiren retroq
Retroviral shRNA Library Construction and Bcl6/Zdhhc2 Knockdown
For the study of Bcl6–shRNA and Zdhhc2-shRNA, Bcl6–shRNA (5′- GATCCGCTGTCAAAGAGAAGGCTTTATTCAAGAGATAAAGCCTTCTCTTTGACAGCTTTTTTGATATCG-3′) was inserted into the retroviral pSIREN-RetroQ_GFP vector, in which the puromycin-resistant gene of pSIREN-RetroQ was replaced by the green fluorescent protein (GFP) gene sequence from the PMKO.1-GFP vector (Addgene), Zdhhc2-shRNA-2 (5′-GATCCGTGACAGATGCCAACTTATAATTCAAGAGATTATAAGTTGGCATCTGTCACTTTTTTGATATCG-3′) and Zdhhc2-shRNA-4 (5′-GATCCGCTACTCCTGCGGGACTAAATTTTCAAGAGAAATTTAGTCCCGCAGGAGTAGCTTTTTTGATATCG-3′) were inserted into the retroviral pSIREN-RetroQ_mCherry vector, and a scramble shRNA (5′- GATCCGTGCGTTGCTAGTACCAACCTATTCAAGAGATAGGTTGGTACTAGCAACGCACTTTTTTGATATCG-3′) was inserted into the retroviral pSIREN-RetroQ_mCherry vector as controls.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!