Quantstudio tm 3 real time polymerase chain reaction system

Manufactured by Thermo Fisher Scientific

The QuantStudio TM 3 Real-Time Polymerase Chain Reaction System is a real-time PCR instrument designed for quantitative nucleic acid analysis. It provides accurate and reproducible results for a variety of applications, including gene expression analysis, genotyping, and pathogen detection.

Automatically generated - may contain errors

Lab products found in correlation

Primescript rt master mix, by Takara Bio (2 mentions) Rneasy mini kit, by Qiagen (1 mentions) Sybr green pcr master mix, by Takara Bio (1 mentions) Tb green premix ex taq 1, by Takara Bio (1 mentions)

Spelling variants of this product

QuantStudio 3 (1144 citations) QuantStudio 3 system (282 citations) Real-Time System (23 citations) QuantStudio Real-Time polymerase chain reaction (PCR) System (4 citations) QuantStudio 3 Real-Time Polymerase Chain Reaction System (3 citations) QuantStudio™ systems (2 citations)

2 protocols using quantstudio tm 3 real time polymerase chain reaction system

Transcriptomic Analysis of Neural Stem Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The CC and neurospheres were collected in TRIzol. Note that neurospheres were used for RNA-sequencing rather than the dissected SVZ to minimize contamination by other nearby areas like the striatum. Total RNA was extracted following manufacturer's instruction and cleaned using RNeasy Mini kit (QIAGEN). 0.5-1 mg of total RNA was used for reverse transcription (RT) using PrimeScript RT Master Mix (Takara). To compare mRNA levels, quantitative RT-PCR was performed using SYBR Green PCR master mix (Takara) in Applied Biosystems QuantStudio TM 3 Real-Time Polymerase Chain Reaction System. See Table S2 for sequences of the primers used in this study.

Huang S., Choi M.H., Huang H., Wang X., Chang Y.C, & Kim J.Y. (2020). Demyelination Regulates the Circadian Transcription Factor BMAL1 to Signal Adult Neural Stem Cells to Initiate Oligodendrogenesis. Cell reports, 33(7).

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Immune Genes in RRMS

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNAs were prepared from total RNA extracted from RRMS patients and healthy controls. 0.5 μg RNA was used for reverse transcription (RT) reaction using PrimeScript RT Master Mix (Takara). To compare mRNA levels, quantitative RT-PCR was performed using TB Green Premix EX Taq I (Takara) in Applied Biosystems QuantStudio^TM 3 Real-Time Polymerase Chain Reaction System following the manufacturer’s instruction. Data were analyzed by the 2-ΔΔCt method. The gene expression was normalized to a control gene, Ribosomal Protein-encoded Gene 13 (RPS13). Sequences of the primers used in this study:

Gene	Forward sequence (5’→3′)	Reverse sequence (5’→3′)
RPS13	AAGTACGTTTTGTGACAGGCA	CGGTGAATCCGGCTCTCTATTAG
IL18R1	CCTTGACCCTTTGGGTGCTTA	CTCATGTGCAAGTGAACACGA
TLR2	TTATCCAGCACACGAATACACAG	AGGCATCTGGTAGAGTCATCAA
TPST1	TTTCTAGGTTATTCCCCAATGCC	AGCACGATTCCACTTTGTCAA
CXCR4	GGGCAATGGATTGGTCATCCT	TGCAGCCTGTACTTGTCCG

Huang S., Wu T., Lau A.Y., Au C., Huang H., Wang X, & Kim J.Y. (2021). Attention to time-of-day variability improves the reproducibility of gene expression patterns in multiple sclerosis. iScience, 24(11), 103247.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!