The detrusor tissue was ground with liquid nitrogen. mRNA was isolated using a TransZol Up Plus RNA Kit (TransGen Biotech, Beijing, China, Code#ER501) according to the manufacturer's instructions. Complementary DNA (cDNA) synthesis was performed using 200 ng mRNA and TransScript II All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (TransGen Biotech). The gene expression levels of SPHK1/2, S1PR1/2/3, RhoA, ROCK1/2, MYPT1, and MLC20 were determined using TransStart Top Green qPCR SuperMix (TransGen Biotech) with the Bio-Rad CFX96 PCR system. Relative gene expressions were measured by the comparative period threshold method. Standardization of relative expression was carried out by comparison to the average expression of the housekeeping gene GAPDH. The primer sequences are listed in Table 1 .
Transscript 2 all in one first strand cdna synthesis supermix for qpcr
Manufactured by Transgene
Sourced in China
TransScript II All-in-One First-Strand cDNA Synthesis SuperMix for qPCR is a laboratory equipment product designed for the reverse transcription and first-strand cDNA synthesis step in quantitative real-time PCR (qPCR) experiments. It provides a complete solution for the conversion of RNA into cDNA.
Automatically generated - may contain errors
Lab products found in correlation
Transstart top green qpcr supermix, by Transgene (2 mentions)
Transzol up plus rna kit, by Transgene (1 mentions)
Cfx96 pcr system, by Bio-Rad (1 mentions)
Easyspin plus plant rna rapid extraction kit, by Aidlab (1 mentions)
Abi 7500 fast, by Thermo Fisher Scientific (1 mentions)
Lightcycler 480 2 real time pcr instrument, by Roche (1 mentions)
Transstart taq dna polymerase, by Transgene (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Primer premier v6, by Premier Biosoft (1 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (1 mentions)
6 protocols using transscript 2 all in one first strand cdna synthesis supermix for qpcr
1
Quantifying Gene Expression in Detrusor Tissue
2
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by using an EASYspin Plus Plant RNA Rapid Extraction Kit (Aidlab Biotech) and RNA integrity and concentration are measured using NanoDrop2000. The first cDNA strand was synthesized with 1 ng total RNA by using a TransScript II All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (TransGen Biotech) based on the manufacturer’s instructions. The qRT-PCR reactions were performed on the ABI 7500 Fast (Applied Biosystems, Foster City, CA, USA) using TransStart Top Green qPCR SuperMix (TransGen Biotech) with specific primers designed by NCBI-Primer-BLAST (Table 1 ). Three technical replicates were used for each sample. The relative gene expression was calculated with the 2−ΔΔCt method [47 ].
3
qRT-PCR Validation of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To validate the expression pattern, we performed qRT-PCR on hub genes and selected DEGs. The samples of cDNA were synthesized from 1µg of total RNA by using TransScript® II All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (TransGen Biotech co., ltd, China). Real-time PCR was performed by using TransStart® Taq DNA Polymerase (TransGen Biotech co., ltd, China) and LightCycler® 480 II Real-time PCR instrument (Roche, Basel, Switzerland). The specific primers for qRT-PCR were designed referring to qPrimerDB (https://biodb.swu.edu.cn/qprimerdb ) (Lu et al., 2018 (link)). Gene expression levels were calculated according to the 2−ΔΔCt method with three biological (Livak & Schmittgen, 2001 (link)).
4
Validating Transcriptome Data via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To verify the validity of the transcriptome data, nine genes were chosen for qRT-PCR. The extraction and quality detection of total RNA were the same as RNA-seq. Total RNA was converted into cDNA using the TransScript® II All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal; TransGen Biotech, Beijing, China), according to the manufacturer’s protocol. Relative expression levels were calculated by the 2−ΔΔCt method, and the Actin gene (Forward primer: ACAACTGCTGAACGGGAAAT, Reverse primer: AATCATAGACGGCTGGAAAAG) was used as a reference for quantitative expression analysis. The primers used in qRT-PCR are listed in Table S1 . The the reagents and reaction conditions of the reverse transcription PCR (RT-PCR) and qRT-PCR can be found in the supplementary tables (Tables S2 –S4 ).
5
Quantitative Assessment of Placental RNA and Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the placenta using RNeasy kits (Qiagen) according to the manufacturer's protocol, and 1 µg of total RNA was reverse transcribed with TransScript II All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (Transgene, Beijing, China). cDNA was quanti ed using SYBR Green PCR Master Mix (Applied Biosystems, USA). The sequences of the primers used for real-time PCR are shown in Table 1. The quantitative fold changes in mRNA expression were determined relative to glyceraldehyde 3phosphate dehydrogenase (GAPDH) mRNA levels in each corresponding group. ELISA Placental tissues were weighed, placed in lysis buffer, homogenized and centrifuged at 10 000 ×g for 5 min. The supernatants were collected, and the ELISA assays were conducted by quantitative sandwich enzyme immunoassays using commercial ELISA kits according to the manufacturer's protocol (Cloud-Clone Corp, Mbbiology, Wuhan, China). For each sample, the assay was conducted in triplicate, with duplicate standard curves.
6
Validation of Cellulose Biosynthesis Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Eight cellulose biosynthesis-involved genes were randomly selected for reverse transcription-quantitative PCR (qRT-PCR) assays to validate the accuracy of RNA-seq analysis. To detect the effect of nitrogen fertilization on the expression of cellulose biosynthesis-involved genes, seedlings were fertilized with different concentrations of urea water solution for 30 days and qRT-PCR were conducted on the leaf samples with a series of genes involved in cellulose synthesis. cDNAs were synthesized from RNA (1 µg in total) by the TransScript II All-in-One FirstStrand cDNA Synthesis SuperMix for qPCR (TransGen Biotech, Beijing, China) following the manufacturer’s instructions. qRT-PCR was performed using the MonAmpTM ChemoHS qPCR mix kit (Monad Biotech, Wuhan, China) and detected using the BIO-RAD CFX96 real-time PCR detection system (BIO-RAD, Pleasanton CA, USA). The PCR cycling parameters used were: denaturation at 95 °C for 5 min and 42 cycles of 95 °C for 10 s, 56 °C for 20 s, and 72 °C for 30 s. According to the output data, relative expressions of the mRNA of each sample were normalized according to the expression level of the internal reference gene PebActin. Three technical and biological replicates were used. The qRT-PCR primers, which were designed using Primer Premier v6.0 (Premier Biosoft, Palo Alto, CA, USA), are listed in Table S6 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!