One step primescript kit

Total RNA from tissues and cells was purified using Trizol reagent (TaKaRa, Otsu, Japan). One Step PrimeScript Kit (TaKaRa) was used for the reverse transcription of isolated RNA. Moreover, qRT‐PCR was carried out using a SYBR Premix Ex Taq kit (TaKaRa) and the CFX96 Real‐Time PCR Detection System (Bio‐Rad, Hercules, California, USA). GAPDH was used as a normalization control, and the relative expression level was calculated using the 2^−ΔΔCt method. FOXD2‐AS1 primers were purchased from Generay Biotech (Shanghai, China) and the sequences are listed in Additional file 2: Table S2.

Total RNAs from cells were extracted using Trizol reagent (TaKaRa, Otsu, Japan) according to the manufacturer’s instructions. Following reverse transcription of isolated RNA (using the One Step PrimeScript Kit; TaKaRa; RR055A), the SYBR Premix Ex Taq kit (DRR420A, TaKaRa) was used to detect the expression of targeted genes and GAPDH using the CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The cycle threshold (CT) value was calculated and the 2^−ΔΔCt method was used to quantify the relative amount of targeted genes, normalized with respect to GAPDH. The primer sequences: NDRG1 (5′-CTGCACCTGTTCATCAATGC-3′ and 5′AGAGAAGTGACGCTGGAACC-3′);PKCδ(5′-GTGCAGAAGAAGCCGACCAT-3′ and 5′-CCCGCATTAGCACAATCTGGA-3′);n-Myc(5′-ACCCGGACGAAGATGACTTCT-3′)and(5′-CAGCTCGTTCTCAAGCAGCAT-3′); c-Myc(5′-GGCTCCTGGCAAAAGGTCA-3′ and 5′- CTGCGTAGTTGTGCTGATGT-3′); Hypoxia inducible factor 1-alpha(HIF-1)5′- GAACGTCGAAAAGAAAAGTCTCG -3′ and 5′-CCTTATCAAGATGCGAACTCACA-3′); Activator protein-1(AP-1) (5′- AACAGGTGGCACAGCTTAAAC -3′ and 5′- CAACTGCTGCGTTAGCATGAG′); P53 (5′- CAGCACATGACGGAGGTTGT -3′ and 5′- TCATCCAAATACTCCACACGC-3′); GAPDH (5′-TTCAACAGCAACTCCCACTCTT-3′ and 5′TGGTCCAGGGTTTCTTACTCC-3′).