Total RNA was extracted from the cultured GC cells, and tissues were harvested using the Trizol reagent (Invitrogen) according to the manufacturer's instruction. To measure the level of miR-141, qRT-PCR was performed by using Taqman probes (Invitrogen) in the Bio-Rad CFX96 real-time PCR system (Bio-Rad, Hercules, CA, USA) according to the manufacturer's instruction. The data were normalized using the endogenous U6 snRNA. For TAZ mRNA detection, reverse transcription was performed using the PrimeScript RT Master Mix (Perfect Real Time, TaKaRa, Dalian, China). Quantitative PCR was performed using SYBR Premix ExTaq II (TliRNaseH Plus; TaKaRa) in Bio-Rad CFX96 real-time PCR system. Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) mRNA was used for normalization. Forward and reverse primers for TAZ (104 bp) and gapdh (226 bp) were 5′-ATCCCAGCCAAATCTCGTGA-3′ and 5′-GCCCTGCGGGTGGGT-3′ and 5′-GAAGGTGAAGGTCGGAGTC-3′ and 5′-GAAGATGGTGATGGGATTTC-3′, respectively. The 2−ΔΔCT method was used in the analysis of PCR data.
Cfx96 real time pcr system
Manufactured by Bio-Rad
Sourced in United States, China, Japan, Germany, France, Italy, Singapore, Spain, United Kingdom, Canada, Lithuania, Switzerland
The CFX96 real-time PCR system is a high-performance, flexible, and reliable platform for real-time quantitative PCR (qPCR) analysis. It features a 96-well block design, advanced optics, and precise temperature control to deliver accurate and reproducible results across a wide range of applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (472 mentions)
Primescript rt reagent kit, by Takara Bio (165 mentions)
Trizol, by Thermo Fisher Scientific (163 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (144 mentions)
Iscript cdna synthesis kit, by Bio-Rad (136 mentions)
Rneasy mini kit, by Qiagen (109 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (92 mentions)
Sybr premix ex taq, by Takara Bio (83 mentions)
Ssofast evagreen supermix, by Bio-Rad (82 mentions)
Itaq universal sybr green supermix, by Bio-Rad (80 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (62 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (61 mentions)
Iq sybr green supermix, by Bio-Rad (61 mentions)
Nanodrop, by Thermo Fisher Scientific (50 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (48 mentions)
Sybr premix ex taq 2, by Takara Bio (46 mentions)
Cfx manager software, by Bio-Rad (39 mentions)
Ssoadvanced universal sybr green supermix, by Bio-Rad (38 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (35 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (29 mentions)
2 365 protocols using cfx96 real time pcr system
1
Quantification of miR-141 and TAZ mRNA
2
Quantifying mtDNA Levels in C. elegans
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent. For cDNA synthesis, mRNA was reverse transcribed using the iScriptTM cDNA Synthesis Kit (BioRad). Quantitative PCR was performed in triplicate using a BioRad CFX96 Real‐Time PCR system (BioRad). To quantify mtDNA levels, we used the primers Mito1 Forward and Mito1 Reverse. The results were normalized to genomic DNA, quantifying the ama‐1 gene using the primers: ama‐1 Forward and ama‐1 Reverse. Quantitative PCR was performed using a Bio‐Rad CFX96 Real‐Time PCR system.
3
Quantifying miR-22 and EMT Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cultured GC cells and tissues harvested by Trizol reagent (Invitrogen, Carlsbad, CA, USA). To measure the level of miR-22, qRT-PCR was performed by using Taqman probes (Invitrogen) in the Bio-Rad CFX96 real-time PCR system (Bio-Rad, Hercules, CA, USA) according to the manufacturer's instruction. The data were normalized using the endogenous U6 snRNA. For MMP14 and Snail mRNA detection, reverse transcription was performed using the PrimeScript RT Master Mix (Perfect Real Time, TaKaRa, Dalian, China). Quantitative PCR was performed using SYBR Premix ExTaq II (TliRNaseH Plus) (TaKaRa) in Bio-Rad CFX96 real-time PCR system. Sense and antisense primers for MMP14 (178 bp) and Snail (234 bp) were 5′-TCGGCCCAAAGCAGCTTC-3′ and 5′-CTTCATGGTGTCTGCATCAGC-3′, and 5′-GGACTCTTGGTGCTTGTGGA-3′ and 5′-GGACTCTTGGTGCTTGTGGA-3′, respectively. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH; sense primer: 5′-GAAGGTGAAGGTCGGAGTC-3′ and antisense primer: 5′-GAAGATGGTGATGGGATTTC -3′) gene was used as gene internal controls. Cycling conditions were 95 °C for 5 min, followed by 39 cycles of 95 °C for 15 s, 60 °C for 20 s and 72 °C for 10 s. Specificity of amplification products was confirmed by melting curve analysis. The 2−ΔΔCT method was used in the analysis of PCR data.
4
Reverse Transcription and qPCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the conversion of mRNA to cDNA, 1 μg of the total RNA was reverse transcripted using using the iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, CA, USA) in accordance to the manufacturer’s instructions. Briefly, 1 μg of the extracted RNA was mixed with enzyme reverse transcriptase and buffer to a volume of 20 μl and subjected to thermal profile of 25 °C for 5 min, 42 °C for 30 min followed by 85 °C for 5 min in accordance to the manufacturer’s instructions.
The quantitative real time polymerase chain reaction (qPCR) was performed using the iTaq™ Universal SYBR® Green Supermix (Bio-Rad Laboratories, CA, USA) on the BioRad CFX96™ Real-Time PCR system (Bio-Rad Laboratories, CA, USA). The primers used in this study are listed inTable 1 . Briefly, 1 μl of cDNA and 1 μl of the forward and the reverse primers were added to iTaq™ Universal SYBR® Green Supermix. The reaction mix was then subjected to thermal profile of denaturation at 95 °C for 30 s, followed by amplification and quantification in 40 cycles at 95 °C for 5 s followed by 60 °C for 30 s. At the end of amplification cycles, melting temperature analysis was performed by the BioRad CFX96TM Real-Time PCR system (Bio-Rad Laboratories, CA, USA). Relative gene expression was quantified based on 2−ΔΔCT method using the housekeeping gene β-actin as the reference gene [25] (link).
The quantitative real time polymerase chain reaction (qPCR) was performed using the iTaq™ Universal SYBR® Green Supermix (Bio-Rad Laboratories, CA, USA) on the BioRad CFX96™ Real-Time PCR system (Bio-Rad Laboratories, CA, USA). The primers used in this study are listed in
5
Real-Time qPCR Analyses on BioRad CFX96
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All RT-qPCR analyses were conducted in 96-well plates using the BioRad CFX96™ Real-Time PCR system (Bio-Rad Laboratories, CA, USA). The PCR program for amplification was as follows: an initial denaturation step of 3 min at 95 °C, and 45 cycles of 95 °C for 10 s, 60 °C for 10 s, and 72 °C for 10 s. A final melting program ranging from 65 °C to 95 °C at increments of 0.5 °C and acquiring the fluorescence after each step. The reaction mixture contained 1 μl of diluted cDNA, 10 μl of SYBR TB Green mix (TaKaRa, Dalian, China), 1 μl of each sense and anti-sense, and 7 μL of ddH2O in 20 μl of total reaction volume. To ensure repeatability of the experiments, each reaction was run in triplicate. A ten-fold dilution series of cDNA samples was used to generate a relative standard curve. The correlation coefficient (R2) and slope were obtained from the linear regression model created by the BioRad CFX96™ Real-Time PCR system. PCR amplification efficiency (E) was calculated according to the formula: E = (10(−1/slope) − 1) × 100.
6
Reverse Transcription and qPCR for miRNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription of intracellular and sEV-miRNA was performed with miScript II RT kit (Qiagen, Hilden, Germany). For cDNA synthesis of sEV-miRNA, an equal amount of small RNA (based on microRNA Qubit assay) was used in every independent assay due to the absent standard internal reference. Moreover, 1 × 109 copies of Caenorhabditis elegans miR-39-3p was added to calibrate the efficiency of RT and qPCR. For cDNA synthesis of intracellular miRNA, 50 ng of total RNA was used. RNU6 was used as internal reference. Real-time qPCR assay was performed using CFX96 Real-time PCR system (Bio-Rad, Hercules, CA, United States). The matched miScript SYBR Green PCR Kit (Qiagen) was used with the provided universal reverse primer and the miRNA specific primers (Supplementary Table 1 ). For detection of cell gene expression, the RT kit (Promega, Madison, WI, United States) was used for cDNA synthesis with the random primers and GAPDH was used as internal reference. Real-time qPCR was performed using CFX96 Real-time PCR system (Bio-Rad). SYBR PCR kit (KAPA Biosystems, Woburn, MA, United States) was used with gene-specific forward primers and reverse primers (Supplementary Table 1 ). Relative expression level was calculated by 2–ΔΔCT method.
7
miRNA and mRNA Quantification by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For miRNA quantification, the Bulge-LoopTM miRNA qPCR Primer Set (RiboBio, Guangzhou, China) was used to detect miRNA expression with a SYBR Green-based PCR Master Mix (Bio-rad) and a Bio-rad CFX96 Real-Time PCR System. For
marker gene quantification, a 1/10 dilution of cDNA was used as a template with a SYBR Green-based PCR Master Mix (Bio-rad) on a Bio-rad CFX96 Real-Time PCR System. The relative expression levels of miRNAs and mRNAs were
calculated using the 2–ΔΔCt method and either U6 or glyceraldehyde-3-phosphate dehydrogenase (Gapdh) as internal controls, respectively, using a previously reported protocol [23 (link)].
marker gene quantification, a 1/10 dilution of cDNA was used as a template with a SYBR Green-based PCR Master Mix (Bio-rad) on a Bio-rad CFX96 Real-Time PCR System. The relative expression levels of miRNAs and mRNAs were
calculated using the 2–ΔΔCt method and either U6 or glyceraldehyde-3-phosphate dehydrogenase (Gapdh) as internal controls, respectively, using a previously reported protocol [23 (link)].
8
Quantification of circRNA, mRNA, and miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol™ Reagent (Invitrogen) and quantified with a microplate reader at 260 nm. For circRNA and mRNA, complementary DNA (cDNA) was synthesized by using 1000 ng RNA as a template and the Prime Script RT-PCR kit (Takara Bio Dalian, China). The expression of specific genes was then determined with a CFX96 Real-Time PCR system (Bio-Rad, CA, USA), SYBR-Green PCR Master Mix (Takara Bio, Dalian, China), and gene-specific primers. 18S was utilized as internal control. The primers used in the research were shown as follows: circIFT80, F: CCGCCCACTGTACAATTCAC and R: TCTTCAGCAGTAGTCCAGCC; 18S, F: GTGGAGCGATTTGTCTGGTT and R: AACGCCACTTGTCCCTCTAA; and β-catenin, F: AAAGCGGCTGTTAGTCACTGG and R: CGAGTCATTGCATACTGTCCAT. For miRNAs, miRNA first-strand cDNA synthesis kit (Takara Bio Dalian, China) was used to generate cDNA for miRNA analysis and SYBR-Green PCR Master Mix (Takara Bio, Dalian, China) was also used to perform the quantitative real-time PCR assay with a CFX96 Real-Time PCR system (Bio-Rad, CA, USA). U6 was used as an internal control. The microRNA primer is shown in supplementary Table 2 . Finally, the expression levels of these genes and miRNAs were calculated by the 2 −ΔΔCT method and presented as a bar chart.
9
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After treatment, total RNA was extracted from NP cells by the TRIzol method (Invitrogen). One thousand nanograms of total RNA was reverse transcribed to synthesize cDNA (MBI Fermentas, Germany) using the PrimeScript-RT reagent kit (Takara, Japan) and the CFX96 Real-Time PCR System (Bio-Rad Laboratories, Berkeley, CA, United States). Amplification of the cDNA was performed by SYBR Premix Ex Taq using the CFX96 Real-Time PCR System (Bio-Rad Laboratories, Berkeley, CA, United States). The cycle threshold (Ct) values were determined and normalized to the level of a housekeeping gene (GAPDH). The expression of the target genes in different groups was evaluated using the 2–ΔΔCt method. The forward and reverse primer sequences are provided in Supplementary Table S1 .
10
Axenic DNA Isolation and qPCR for Ustilago maydis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For axenic cultures, U. maydis DNA isolation was performed as previously described (Tsukuda et al. 1988 (link)) from cell cultures at the indicated times. For qPCR, 1 µg of genomic DNA was used per reaction using specific primers and the SsoAdvanced Universal SYBR Green Supermix (BioRad) in a CFX96 Real-Time PCR system (BioRad). Reaction conditions were as follows: 3 min 95°C followed by 40 cycles of 10 s 95°C/10 s 60°C/30 s 72°C.
For qPCR assays of plant-infected fungal genomic DNA, infected plant tissue (100–300 mg) was harvested seven days post-inoculation, shock frozen with liquid nitrogen, and ground into a fine powder using a mortar. Genomic DNA was isolated from ground powder as described previously (Hoffman and Winston 1987 (link)). qPCR was performed using MESA GREEN qPCR MasterMix (Eurogentec) in a CFX96 Real-Time PCR system (BioRad). Cycling conditions were as follows: 7 min 95°C followed by 45 cycles of 30 s 95°C/20 s 60°C/40 s 72°C; specificity of PCR products was checked by melting curve analysis from 55°C to 95°C.
For qPCR assays of plant-infected fungal genomic DNA, infected plant tissue (100–300 mg) was harvested seven days post-inoculation, shock frozen with liquid nitrogen, and ground into a fine powder using a mortar. Genomic DNA was isolated from ground powder as described previously (Hoffman and Winston 1987 (link)). qPCR was performed using MESA GREEN qPCR MasterMix (Eurogentec) in a CFX96 Real-Time PCR system (BioRad). Cycling conditions were as follows: 7 min 95°C followed by 45 cycles of 30 s 95°C/20 s 60°C/40 s 72°C; specificity of PCR products was checked by melting curve analysis from 55°C to 95°C.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!