Myiq thermal cycler

Total mRNA for qRT-PCR and PCR array studies was extracted from cells using RNeasy Mini Plus kit (Qiagen, 74134) according to the manufacturer’s protocol. cDNA was synthesized from 1μg of total mRNA using High-capacity cDNA reverse transcript kit (Applied Biosystems, 4368814) following the manufacturer’s protocol. qRT-PCR experiments were performed in a MyiQ thermal cycler (BioRad) with Sybr-Green mastermix (BioRad, 170–8882) and 200 ng of template/reaction using primers (Operon) designed using the Primer3/NCBI Primer-BLAST tool69 (link) (Table 3).
The following thermal cycling settings were used: 95 °C for 10 min. followed by 40 cycles at 95 °C for 30 sec., 62 °C for 1 min. and 72 °C for 1 min. The fold-change values were calculated as delta-delta Ct (ddCt) values from a minimum of three independent biological replicates.
The PCR array study was performed with an 84-gene EMT pathway-specific array (SABiosciences, PAHS-090Z) according to the manufacturer’s protocol. The top 20 genes were ranked by fold change magnitude and analyzed for KEGG pathway enrichment using the DAVID bioinformatics tool70 (link).

Total RNA was extracted from scleral fibroblast using the RNeasy kit (Qiagen, Hilden, Germany), including an on-column DNase I digestion step. First-strand cDNA synthesis from 0.1 μg of total RNA and quantitative RT-PCR were performed using the MyIQ thermal cycler and software (Bio-Rad Laboratories, Munich, Germany). PCRs (25 μL), run in duplicate, contained 2 μL of first-strand cDNA, 0.4 μM each of upstream and downstream primers (Macrogen, Inc., Seoul, Korea), and IQ SYBR Green Supermix (Bio-Rad Laboratories). The primers and PCR conditions are as follows; Collagen type I (Forward, GGCTACTTCTCGCTCTGCTTCATC; Reverse, TGGGCAAACTGCACAACATTCTCC), αSMA (Forward, CTATGCCTCTGGACGCACAACT; Reverse, CAGATCCAGACGCATGATGGCA), IL-1β (Forward, CCACAGACCTTCCAGGAGAATG; Reverse, GTGCAGTTCAGTGATCGTACAGG), IL-6 (Forward, AGACAGCCACTCACCTCTTCAG; Revese, TTCTGCCAGTGCCTCTTTGCTG), and GAPDH (Forward, AGCTCACTGGCATGGCCTTC; Reverse, ACGCCTGCTTCACCACCTTC) summarized in Table. For quantification, serially diluted standard curves of plasmid-cloned cDNA were run in parallel, and amplification specificity was checked using melt curves and sequence analyses on the CPX96 Real Time PCR Machine (Bio-Rad Laboratories). mRNA ratios relative to the housekeeping gene GAPDH were calculated to normalize gene expression levels. For each analyzed tissue, three samples were pooled in each group.

M. tb strains were cultured as described above with shaking at 220 rpm till A₅₉₅ ~ 0.2–0.3. A 50 ml aliquot was centrifuged and RNA was isolated using TRI reagent method as described [16 (link)]. Reverse transcription was performed on the total extracted RNA with random hexamer primers and cDNA High capacity Reverse Transcriptase kit (ABI, USA). mRNAs were quantitated by real-time PCR using gene-specific primers (Additional file 1: Table S1) in MyIQ thermal cycler (Biorad, USA). For whole genome transcriptome, the data deposited with NCBI GEO datasets (Accession number GSE30264) was analysed as described previously [16 (link)].

Cells were cultured in DMEM+10% FBS in 100 mm tissue culture dishes until ∼70% confluence and then treated with DMSO alone or increasing concentrations of FH535 in DMSO for 38 h. For RNA analysis, cells were harvested and cDNA was prepared as described [21] (link). Quantitative PCR was carried out with SYBR green using the Bio-Rad MyiQ thermal cycler with the following primers: Survivin (BIRC5, CAAGGAGCTGGAAGGCTGG and GTTCTTGGCTCTTTCTCTGTCC), Cyclin D1 (CCND1: GGATGCTGGAGGTCTGCGA and TAGAGGCCACGAACATGCAAGT), and β2-microglobulin (B2M: GACTTTGTCACAGCCCAAGATAG and TCCAATCCAAATGCGGCATCTTC).