The largest database of trusted experimental protocols

76 protocols using ethanol

1

Synthesis of Titania-Silica Nanocomposites

Check if the same lab product or an alternative is used in the 5 most similar protocols
Iron chloride hexahydrate (FeCl3·6H2O), sodium citrate tribasic dehydrate, sodium acetate (NaAc), bisphenol-A, concentrated ammonia solution (28 wt%), t-butanol, titanium(iv) isopropoxide (TIPO), TiO2 (P25, 20% rutile and 80% anatase) and tetraethyl orthosilicate (TEOS) were analytical grade and purchased from Sigma-Aldrich (USA). Sodium hydroxide (NaOH), hydrochloric acid (HCl, 36%), perchloric acid (HClO4), potassium bi-phthalate (C6H4COOKCOOH, 99.7%), ammonium molybdate ((NH4)6Mo7O24·4H2O, 99.0%), ethylene glycol and ethanol were purchased from Samchun Pure Chemicals. All chemicals were analytical grade and used as received without further purification. Corp. deionized water was used for all experiments.
+ Open protocol
+ Expand
2

Fabrication of Serotonin Aptamer Biosensor

Check if the same lab product or an alternative is used in the 5 most similar protocols
3,4-Ethylenedioxythiophene (EDOT), polyacrylonitrile (PAN), dimethylformamide (DMF), ferric chloride, 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMTMM), hexamethyldisilazane (HMDS), 3,4-Dimethoxythiophene, p-toluenesulfonic acid monohydrate (pTsOH·H2O), butylated hydroxytoluene (BHT), tetrahydrofuran (THF), and Sylgard 184 polydimethylsiloxane (PDMS) were obtained from Sigma–Aldrich. Ethanol, toluene, mEthanol, hexane (Hex), hydrochloric acid (HCl), and ethyl acetate (EtOAc) were obtained from Samchun. Sodium hydroxide (NaOH) was purchased from Daejung. (S)-Methyl 2,3-dihydroxypropanoate (Methyl glycerate) was purchased from Combi-Block. AZ5214E was obtained from Clariant. A serotonin aptamer with the sequence 5′-CGACTGGTAGGCAGAT AGGGGAAGCTGATTCGAGCGTGGGTCG[C6 Amine]-3′ was synthesized by Bioneer. Phosphate buffered saline (PBS) pH 7.4 (1 ×) was purchased from Gibco™, and simulated blood serum and artificial CSF were purchased from Biochemazone. All reagents and solvents were used as received without further treatment.
+ Open protocol
+ Expand
3

Synthesis of Copper-Alginate Composite

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sodium alginate, calcium chloride, benzene, copper sulfate, nitric acid, ethanol, and HPLC-grade water were purchased from Samchun Pure Chemical Co., Ltd. (Gyeonggi-do, Republic of Korea). Sodium citrate was purchased from Deajung Chemical & Metals Co., Ltd. (Gyeonggi-do, Republic of Korea). Wood powder from pitch pine (Pinus rigida) was obtained from G-Biotech (Seoul, Republic of Korea). All the other chemicals used in this study were of analytical grade and used without further purification.
+ Open protocol
+ Expand
4

Fullerene C70 Synthesis and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols
Fullerene C70 (MTR LTD, 98+%), mesitylene (Alfa Aesar, 98+%), isopropanol (Sigam Aldrich, anhydrous, 99.5%), ethanol (Samchun, anhydrous, 99.9%), 1-propanol (Sigma Aldrich, for HPLC, ≥99%), 1-butanol (Sigma Aldrich, 99.8%, HPLC grade), and acetone (Sigma Aldrich, for HPLC, ≥99.9%) were purchased and used without further purification.
+ Open protocol
+ Expand
5

HPLC-Based Antioxidant Evaluation

Check if the same lab product or an alternative is used in the 5 most similar protocols
HPLC solvents including methanol (≥ 99.9%), water (≥ 100%), and acetonitrile (≥ 99.9%) were purchased from J.T. Baker (Phillipsburg, NJ, USA). Folin-Ciocalteu reagent, gallic acid (3,4,5-trihydroxybenzoic acid, ≥ 99%), kaempferol (≥ 97%), quercetin (≥ 95%), DPPH (≥ 100%), ABTS·+ (≥ 100%), trolox (≥ 97%) were purchased from Sigma-Aldrich (St. Louis, MO, USA). methanol (≥ 99%; Duksan, Gyeonggi-do, Korea), Na2CO3 (≥ 99.9%; Duksan), ethanol (≥ 99.9%; Samchun, Pyeongtaek, Gyeonggi-do, Korea), aluminum chloride (98%; Junsei, Japan), and potassium acetate (≥ 99%; Duksan) were also used.
+ Open protocol
+ Expand
6

Perovskite Solar Cell Fabrication

Check if the same lab product or an alternative is used in the 5 most similar protocols
SnCl2 dihydrate, TGA, urea, Zn powder, detergent for an ultrasonic cleaner, MACl, dimethylformamide (DMF), dimethyl sulfoxide (DMSO), oleylamine, octane, chloroform (CF), Bis(trifluoromethane)sulfonimide lithium salt (Li-TFSI), 4-tert-butylpyridine (tBP), acetonitrile (AN), and chlorobenzene (CB) were purchased from Sigma-Aldrich. FAI (FA: formamidinium), MABr (MA: methylammonium), and OAI were purchased from Greatcell Solar. PbI2 and PbBr2 were purchased from TCI. spiro-OMeTAD and tris(2-(1H-pyrazol-1-yl)-4-tert-butylpyridine)cobalt(III)tris(bis(trifluoromethylsulfonyl)imide)) (FK209) were purchased from LumTec. HCl, ethanol, acetone, and isopropyl alcohol (IPA) were purchased from Samchun. Ethyl ether was purchased from Duksan. Fused silica substrates were purchased from Hanjin Quartz. Fluorine-doped tin oxide (FTO) substrates were purchased from Asahi. Au was purchased from iTASCO. All chemicals were used as received without further purification.
+ Open protocol
+ Expand
7

Synthesis of MoS2 Powder

Check if the same lab product or an alternative is used in the 5 most similar protocols
MoS2 powder was purchased from Sigma-Aldrich (Merck, Darmstadt, Germany). NMP, N,N-dimethylformamide, hydrochloric acid (HCl), dimethyl sulfoxide, and ethanol were purchased from Samchun Chemical, Inc (Seoul, Republic of Korea). Isopropyl alcohol and hydrazine monohydrate were purchased from JUNSEI (Tokyo, Japan). All chemicals were used without further purification.
+ Open protocol
+ Expand
8

Polymer-Based Catalytic Nanocomposites

Check if the same lab product or an alternative is used in the 5 most similar protocols
PPO, azobisisobutyronitrile (12 wt % in acetone), and PEI (branched, molecular weight, ~800) were purchased from Sigma-Aldrich. N-bromosuccinimide (NBS; 98%), chlorobenzene (98%), FDA (GC grade 98%), EDA (99%), mmen (98%), and DETA (>98%) were purchased from TCI company. 1,2-Dichloroethane (99 + % grade) was purchased from Alfa Aesar. Iron(III) chloride anhydrous (FeCl3; 98%) was from Thermo Fisher Scientific. Chloroform (high-performance liquid chromatography grade, 99.8%) was purchased from Dae-jung Korea. Methanol (high-performance liquid chromatography grade, 99.90%) and ethanol (Extra Pure grade, 95%) were purchased from Sam-chun chemicals.
+ Open protocol
+ Expand
9

Multisection Soft Pneumatic Actuator

Check if the same lab product or an alternative is used in the 5 most similar protocols
The rigid section paste was prepared by mixing 3.0 g of polydimethylsiloxane (PDMS, 10:1 mixture of a prepolymer: curing agent, Sylgard 184, Dow Corning, Midland, MI, USA), 4.5 g of glass fiber (GF) (milled fiber glass 50 um, Fiberman, Burnaby, BC, Canada), and 0.3 g of hexane (Daejung Chemicals & Materials Co., Siheung-si, Gyeonggi-do, Korea) using a Thinky Mixer (ARE-310, Japan) for 3 min, deformed for 1 min, and then mixed for 1 min. The intermediate section paste was prepared by mixing high-viscosity PDMS (10:1 mixture of a prepolymer:curing agent, Sylgard 186, Dow Corning) using a Thinky Mixer for 3 min, deformed for 1 min, and then mixed for 1 min. The soft section solution was prepared by mixing PDMS (20:1, Sylgard 184) and a reverse-micelle-induced (RMI) solution. First, a solution for the aqueous core of the RMI was prepared by stirring 1.0 mL of ethanol (95%, Samchun Chemical) and 0.1 g of 5-amino-1-pentanol (95%, Sigma-Aldrich, St. Louis, MO, USA) [22 (link)]. Then, 0.1 mL of the solution was mixed with 5.0 mL of octane (95%, Samchun Chemical Co., Seoul, Korea) and 1.0 mL of 1-octanol (99%, Sigma-Aldrich). Finally, 1.5 mL of the RMI solution was mixed with 10.0 g of PDMS (20:1, Sylgard 184).
+ Open protocol
+ Expand
10

Synthesis of Mesoporous Bioactive Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols
MBN was synthesized using a modified sol-gel process. Briefly, 3.12 g calcium nitrate tetrahydrate (Ca(NO3)2·4H2O) (Sigma-Aldrich, St. Louis, MO, USA), 2 mL aqueous ammonia (Samchun, Seoul, Korea), 10 mL 2-ethoxyethanol (Sigma-Aldrich, St. Louis, MO, USA), 20 mL ethanol (Samchun, Seoul, Korea), and 1 g hexadecyltrimethylammonium bromide (CTAB) (Sigma-Aldrich, St. Louis, MO, USA) were mixed in 150 mL distilled water. The mixture was stirred at room temperature for 30 min. Then, 5 mL tetraethyl orthosilicate (TEOS; Sigma-Aldrich, St. Louis, MO, USA) was added and stirred at room temperature for 30 min. Subsequently, 0.25 mL triethyl phosphate (TEP; Sigma-Aldrich, St. Louis, MO, USA) was added and the mixture was vigorously stirred for 4 h at room temperature. A white precipitate was formed and dried in a vacuum oven at 60 °C for 24 h. The dried gel powder was calcined at 600 °C for 5 h. The molar ratio of SiO2:CaO:P2O4 was calculated to be 60:36:4.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!