The probe that detects the KanMX gene was obtained by NotI-digestion of the pFA6-kanMX4 plasmid [79 (link)]. The probe that detects DSB induction was a PCR fusion product of the KanMX coding sequence and the LTE1 locus, which were amplified by the primer pair KSX050/89 and KS3004/3005, respectively. The probe that detects endogenous telomeres or telomere addition at the ADH4 locus has been described [35 (link),78 (link)]. DNA probes were DIG-dUTP—or 32P-labeled by using the DIG prime (Roche) or the Random Primer DNA Labeling Kit (Clontech), respectively. Genomic DNA was purified using a MasterPure yeast DNA purification kit (Epicentre).
Random primer dna labeling kit
Manufactured by Takara Bio
Sourced in Japan, China
The Random Primer DNA Labeling Kit is a versatile tool for incorporating labeled nucleotides into DNA molecules. It utilizes random primers to initiate DNA synthesis, enabling the incorporation of labeled dNTPs into the newly synthesized DNA strands.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Phosphorimager, by Fujifilm (3 mentions)
32p dctp, by PerkinElmer (2 mentions)
Illustra microspin g 25 column, by GE Healthcare (2 mentions)
Hybond n nylon membrane, by Cytiva (2 mentions)
Hybond n membrane, by Cytiva (2 mentions)
Nylon membrane, by GE Healthcare (2 mentions)
Image lab software, by Bio-Rad (2 mentions)
Gel doc xr, by Bio-Rad (2 mentions)
Masterpure yeast dna purification kit, by Illumina (1 mentions)
Ab9106, by Abcam (1 mentions)
Plan apochromat 100, by Zeiss (1 mentions)
Axio imager z1 fluorescence microscope, by Zeiss (1 mentions)
Cy3 dctp, by GE Healthcare (1 mentions)
Cy5 dctp, by GE Healthcare (1 mentions)
Cy3 conjugated anti mouse igg, by Jackson ImmunoResearch (1 mentions)
Alexa flour 488 conjugated anti rabbit igg, by Thermo Fisher Scientific (1 mentions)
Axiovision 4, by Zeiss (1 mentions)
Sybr green rt pcr kit, by Qiagen (1 mentions)
Plant rneasy extraction kit, by Qiagen (1 mentions)
24 protocols using random primer dna labeling kit
1
Detecting Genes and Telomeres in Yeast
2
RNA Isolation and Northern Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA isolation and Northern blot analyses were performed as previously described [42 (link), 44 (link)]. The DNA probes for Northern blot analysis were amplified using the appropriate oligonucleotide pairs (Table 2 ) from the coding regions of individual genes using FGSC4 genomic DNA as a template. 32P-labeled probes were prepared using the Random Primer DNA Labeling Kit (Clontech) with [α-32P]-dCTP. Genomic DNA extractions were carried out as previously described [43 (link)].
3
Genomic DNA and Total RNA Isolation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA and total RNA isolation was carried out as previously described18 (link)56 (link). In Northern blot analyses, DNA probes were prepared by PCR amplification of the coding region of individual genes with appropriate oligonucleotide pairs using FGSC4 genomic DNA as template (Table S1 ). Probes were labelled with 32P-dCTP (PerkinElmer) using Random Primer DNA Labeling Kit (Takara) and purified by illustra MicroSpin G-25 columns (GE Healthcare).
4
Northern Blot Analysis of Virus Small RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Northern blot analysis of virus-derived small RNAs and RDV genomic RNA was performed as described previously [9 (link)]. Probes partially complementary to the RDV genomic S11 and small RNA were labeled with α-32P-dCTP using a Random Primer DNA Labeling Kit (TaKaRa). Probe with a sequence complementary to U6 was used as a loading control. The Northern blot analysis probes of S11 were: S11-F1 (+): 5′-TCCGGGACCGGCTAACTCGACTGACCCACAGTGCCGATGCCTACCGACGACTGAATGACTTCGAAACAAGCATAATTTAG -3′; S11-R1(−):5′- AATGAGTGGAACATTACCCTTGGCTATGACGGCGAGTGAATCATTCGTTGGCATGCAAGTTTTGGCTCAAGACAAAGAAGTC -3′; vsiRNA (+): 5′-AGCCTTACTTACGCTTTGATT-3′; vsiRNA (−): 5′- GCTGCTTGATCACGTAGCTT-3′.
5
Fluorescence Microscopy Imaging Protocol
6
RNA Extraction and Transcript Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the frozen samples using the Plant RNeasy extraction kit (Qiagen, Valencia, CA, USA). The splicing pattern of the intron-containing genes was analyzed by RT-PCR using the gene-specific primers listed in Additional file 8 as previously described [43 (link)]. Splicing efficiency was measured by real-time RT-PCR using the gene-specific primers listed in Additional file 9 as previously described [32 (link), 41 (link)]. The levels of chloroplast transcripts were measured by quantitative RT-PCR using the gene-specific primers listed in Additional file 10 . Real-time RT-PCR was carried out on a Rotor-Gene Q thermal cycler (Qiagen) using a SYBR Green RT-PCR kit (Qiagen). For northern blot analysis, four or five micrograms of total RNA were separated on a 1.2% formaldehyde-agarose gel and transferred to a Hybond-N+ nylon membrane (Amersham Biosciences, Parsippany, NJ, USA). The [α-32P]-labeled probes were synthesized using a random primer DNA labeling kit (TaKaRa Bio., Shiga, Japan). Hybridization, washing, and detection of signals were performed essentially as described previously [32 (link)].
7
Fission Yeast Telomere Length Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fission yeast genomic DNA was digested with EcoRI, resolved on a 1% agarose gel, and then transferred onto a Hybond-XL membrane (GE Healthcare) using a TurboBlotter (Whatman). The membrane was UV autocrosslinked at 120 mJ/cm2 (Stratalinker 1800). The 0.3-kb ApaI-EcoRI fragment of pTELO [81 (link)] was used as a template to generate a probe using the Takara Random Primer DNA Labeling Kit (Takara).
8
Genomic DNA Extraction and Southern Blot Analysis of HbSUT5
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA of Reyan7–33-97 was extracted from mature leaves using the CTAB DNA extraction method. One pair of primers (the sense primer: 5′-AACAAAGAAACAGTTGCTGGATAAG-3′ and the reverse primer: 5′-CCTGAGTCATGTTATTAGCCAC-3′) was designed based on the cDNA and genomic sequences of HbSUT5, and used to amplify an intron-free fragment of 530-bp long that contains no enzyme cutting sites of Bcu I, Xba I, BspT I and Bcl I. The amplified fragment was digoxigenin-labeled with the Random Primer DNA Labeling Kit (TaKaRa, China), and used as the probe in subsequent Southern blot analysis. The 10 μg genomic DNA was digested by Bcu I, Xba I, BspT I and Bcl I overnight. The digested product was separated on 0.8% agarose gel and transferred onto a Hybond-N+ membrane (Amersham Pharmacia, USA). And the protocols of Southern blot analysis were performed according to the detailed instructions [67 ]. The Reverse Northern blot assays were performed to analyze the relative transcript abundance of the six HbSUT genes in bark as described previously [19 (link)].
9
Small RNA Detection via Northern Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 4-week-old mature leaves with Trizol reagent (Invitrogen). 50 μg of RNA enriched for small RNAs was separated by acrylamide gel electrophoresis, followed by Northern blot analysis according to published protocols44 (link). To detect small RNAs at the target regions, a PCR fragment was labeled with 32P-α-dCTP by using the Random primer DNA labeling kit (Takara). The miR167, miR159, U6 and LNA were probed with end-labeled oligonucleotides by T4 polynucleotide kinase (NEB). Northern blot signals were detected with a phosphor imager (Fuji). For RT- and qRT-PCR, total RNA was treated with Turbo DNA-free (Ambion) and reverse transcribed by TransScript II (TransGen Biotech) with gene specific primers or oligo (dT) primer. For detection of antisense transcripts, 2 pmol of forward primer was used for reverse transcription reaction in 20 μl volume. The sequences of the primers and oligonucleotides are listed (Supplementary Table S1 ).
10
Screening Transformed Clones via Dot-Blot Hybridization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transformed clones were screened using dot-blot hybridization, following the method described by Zhang et al. (2016) (link). For probe labeling, the rye genomic DNA was labeled by digoxigenin-11-dUTP with a random primer DNA labeling kit (Takara Bio, Shiga, Japan) according to the manufacturer’s instructions, but using 1× DIG DNA labeling mix instead of the dNTP in the kit. The darker blots, which were interpreted as high copy number repetitive sequences, were then used in subsequent FISH for chromosomal distribution analysis and sequence identification.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!