Five randomized samples of total RNAs of hepatitis C patients were selected (pre-dose and post-dose) and combined separately. Each combined samples of total RNAs were purified by using Biostic Blood Total RNA Isolation Kit (MOBIO Laboratories, Inc.). The purified total RNAs were further purified and concentrated to 10.0 μl by using by Gene Jet RNA Clean up and Concentration Micro Kit (Thermo Scientific, EU, Lithuania). The key cytokines and other biomarkers were estimated by real-time RT-PCR, which was carried out on total RNA isolated from plasma samples of hepatitis C patients (pre-dose and post-dose). Taqman primer-probes and Step-one RT-PCR kit (Life Technologies (Foster City, California) were used for these estimations. All reactions performed in triplicate using equal amount of total RNA per reaction. Reverse-transcriptase step involved incubation at 48 °C for 15 min. The real-time (RT-PCR) cycling conditions included an initial denaturation at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s, and 60 °C for 60 s. Real-time PCR assays were completed using a Step-one plus Real time-PCR kit. Relative gene expression of hepatitis C patients of pre-dose versus post-dose samples were normalized (2−ΔΔCT analysis) to GAPDH.
Biostic blood total rna isolation kit
Manufactured by Qiagen
The Biostic Blood Total RNA Isolation Kit is a laboratory equipment product designed for the extraction and purification of total RNA from human blood samples. It provides a reliable and efficient method for isolating high-quality RNA for further analysis and downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using biostic blood total rna isolation kit
1
Hepatitis C Biomarker Analysis
2
Genetic Screening for MYLK3 Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from peripheral white blood cells of all subjects using the DNA extractor 341 Nucleic Acid Purification System (GENEPURE, PE Biosystems) or a Wizard Genomic DNA Purification Kit (Promega). Exon coding sequences and exon‐intron boundaries for MYLK3 were amplified by PCR. The primers are shown in Table1 . High resolution melting analysis (LightScanner System, Idaho Technology) was used for screening mutations. We performed direct sequencing using an ABI PRISM 310 Genetic Analyzer (Applied Biosystems) when irregular profiles were detected. The presence or absence of mutations was confirmed by digestion of PCR products with restriction enzyme Bccl. This method was also used to determine the genotype of DNA from family members of the probands and 400 chromosomes of 200 healthy individuals without cardiovascular disease.
To identify an aberrant transcript that resulted from the splice acceptor site mutation, total RNA was isolated from lymphocytes using a BiOstic® Blood Total RNA Isolation Kit (MO BIO Laboratories). RNA was subjected to reverse transcription, and the DNA products were amplified by PCR. The primers were forward: 5′‐ggaccgggaggacgtgaagaac‐3′; reverse: 5′‐aagtccttggcctcctccgagag‐3′.
To identify an aberrant transcript that resulted from the splice acceptor site mutation, total RNA was isolated from lymphocytes using a BiOstic® Blood Total RNA Isolation Kit (MO BIO Laboratories). RNA was subjected to reverse transcription, and the DNA products were amplified by PCR. The primers were forward: 5′‐ggaccgggaggacgtgaagaac‐3′; reverse: 5′‐aagtccttggcctcctccgagag‐3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!