Reverse transcript kit

Total RNA was extracted from 1.0 cm length of injured cord segments or cultured cell via TRizol (Takara). Then extracted RNA received reverse transcription utilizing a reverse transcript kit (Takara). We performed real‐time PCR for TNFα, iNOS, CD86, IL‐12, IL‐18, CD206, Arginase1, IL‐4, IL‐10, and IRF‐3 with SYBR green (Takara) on Bio‐Rad PCR system (Bio‐Rad). The primers of these genes are listed in Table S1. Gene expression levels were determined by 2^−ΔΔCT method and the data were presented normalized by GAPDH.

Total RNAs were isolated from serum samples and cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Shanghai, China) as per the instructions. Then, cDNA was reverse synthesized from RNAs using a reverse transcript kit (Takara, Japan). RT‐q PCR was then conducted via SYBR Green PCR Master Mix (Takara, Japan) on a 7500 ABI real‐time PCR instrument (Applied Biosystems; Thermo Fisher Scientific, Inc., Shanghai, China). The expressions of lncRNA MALAT1 and miR‐240 were normalized to that of U6, calculated with the 2^−ΔΔCT method. The primers sequences were as follows: IL‐1β (forward), 5′‐ATGATGGCTTATTACAGTGGCAA‐3′, and (reverse) 5′‐GTCGGAGATTCGTAGCTGGA‐3′; IL‐6 (forward), 5′‐ACTCACCTCTTCAGAACGAATTG‐3′, and (reverse) 5′‐CCATCTTTGGAAGGTTCAGGTTG‐3′; TNF‐α (forward), 5′‐CTCTTCTGC CTGCTGCACTTTG‐3′, and (reverse) 5′‐ATGGGCTACAGGCTTGTCACTC‐3′; lncRNA MALAT1 (forward), 5′‐TGTGACGCGACTGGAGTATG‐3′, and (reverse) 5′‐CAAAGGGACTCGGCTCCAAT‐3′; miR‐204 (forward), 5′‐TGGCTACAGTCTTTCTTCA‐3′, and (reverse) 5′‐CTCATGGGACAGTTATGG‐3′; APOL1 (forward), 5′‐TAAGGTACCGACAGAGGGAGGCAGCC‐3′, and (reverse) 5′‐ACCGTCGACTCAGAAGGGTGCCAGACCC‐3′; U6 (forward), 5′‐GCTTCGGCAGCACATATACTAAAAT‐3′, and (reverse) 5′‐CGCTTCACGAATTTGCGTGTCAT‐3′; GAPHD (forward), 5′‐TGCACCACCAACTGCTTAGC‐3′, and (reverse) 5′‐GGCATGGACTGTGGTCATGAG‐3′.

Total RNA from DPCs was extracted with Trizol Reagent (Invitrogen) according to the manufacturer’s instructions. cDNA was prepared with 1 μg total RNA using a reverse transcript kit (Takara). qRT-PCR was performed using the CFX96 Real-Time System (Bio-Rad Laboratories) with SYBR Premix Ex Taq II (Takara). Relative gene expression was analyzed using a 2^-ΔΔCt method and normalized to the expression of the housekeeping gene Gapdh.