Pcdna6.2 gw emgfp mir vector

The Lin28 overexpression plasmid was bought from Era Biotech, and the plasmids was validated by sequencing. Expression plasmid of miR-638 was constructed by PCR using human genomic DNA as a template. PCR product (containing pre-miRNA) was digested with BamHI/XhoI and ligated into pcDNA6.2-GW/EmGFP-miR vector (Invitrogen) to yield pcDNA6.2-miR-638 which was confirmed by DNA sequencing. Three siRNA sequences of the target gene VASP and CREB were designed respectively (Shanghai GKS), and then synthesized the interference plasmid separately. pLKO-GFP-siVASP1 (target sequence: AAGGAGGTGGGCCCCTCC), pLKO-GFP-siVASP2 (target sequence: ACGGGTCCCCAGGCCTTCA), pLKO-GFP-siVASP3 (target sequence: AGCCGGACTCTATGGGGCG), pLKO-GFP-siLin28A (target sequence: CTACAACTGTGGAGGTCTA), pLKO-GFP-siLin28B (target sequence: CTCCTTCTTTTAGGCTTCTAA), pLKO-GFP-siTUT4 (target sequence: GCAGCTATTGATCCTAGAG), and control plasmid pLKO-GFP-siCon (control sequence: GCAAGCTGACCCTGAAGTT). After plasmids were transfected into 293T and MCF-7 cells by Lipofectamine 2000 transfection reagent, qPCR was used to detect the interference efficiency. The lentivirus vector was constructed with the highest interference efficiency sequence. Then cells with the highest interference efficiency were selected, passaged and saved. The primers of plasmids construction can be seen in Supplementary Table 1.

amiRNA sequences were designed using Block-iT RNAi Web Designer tool (Invitrogen, Inc., Carlsbad, CA). We aligned 3′UTR genomic sequences of the different genotypes of JEV strains [(1) Vellore P20778 (AF080251), (2) GP78 (AF075723), (3) SA14-14-2 (AF315119.1), (4) Nakayama strain (EF571853), (5) isolate JEV/SW/GZ/09/2004 China (KF297916), and (6) isolate JEV/eq/India/H225/2009 (JX131374)], and then designed amiRNAs targeting the highly conserved regions across the JEV 3′UTR by using Invitrogen online tool Block-iT RNAi Designer (http://rnaidesigner.invitrogen.com/rnaiexpress). We selected top three high scoring amiRNA sequences and the oligos were synthesized (Sigma) along with a control sequence, which was not specific against JEV 3′UTR sequence (Fig. 1A and Table 1). amiRNAs were cloned into pcDNA™6.2-GW/EmGFP-miR vector (Invitrogen, Inc.) according to the manufacturer's protocol (Fig. 1A). The amiRNA expressed was based on the natural structure of Mus musculus miR-155. An amiRNA targeting LacZ gene was also included as a negative control (NC) in this study. To avoid off-target effects, all of these amiRNA sequences were analyzed using NCBI Blastn against human and mouse transcript sequences.

To construct p11 over-expression plasmid, a 319-bp product of p11 cDNA was amplified using PCR. The forward primer was 5′-CCCAAGCTTATGCCATCTCAAATGG-3′ (with a HindIII restriction enzyme site), and the reverse primer was 5′-CGGAATTCCTACTTCTTTCCCTTC-3′ (with an EcoRI restriction enzyme site). The PCR products were cut using enzymes HindIII and EcoRI, followed by cloning into the pcDNA3.0 vector (Invitrogen, USA). The p11-miRNA plasmid (sense sequence: 5′-TGACACCTGAGAACTCATGGAAA-3′ and anti-sense sequence: 5′-TTTCCATGAGTACTCTCAGGT-3′) and its corresponding control plasmid (miRNA-control) (sense sequence: 5′-TGACGTCTCCACGCAGTACATTT-3′ and anti-sense sequence: 5′-AAATGTACTGCGCGTGGAGAC-3′) were constructed using pcDNA6.2-GW/EmGFP-miR vector by Invitrogen.

The sequences of the miR-497 precursor (MIR497) and the miR-34a precursor (MIR34A) were amplified with oligonucleotide primers synthesized by Invitrogen (Figure S4). MIR497 and MIR34A were then inserted individually into the pcDNA™6.2-GW/EmGFPmiR vector (Invitrogen) using the BLOCK-iT™ Pol II miR RNAi Expression Vector Kit (Invitrogen), to generate the expression constructs Hi-miR497 and Hi-miR34a, respectively. These were verified by DNA sequencing with the primer 5′- CTCTAGATCAACCACTTTGT-3′ in an ABI Prism 373 Genetic Analyzer (Applied Biosystems). The empty pcDNA™6.2-GW/EmGFPmiR vector was used as the negative control (mock). To investigate the cooperative activities of miR-497 and miR-34a, we used the isocaudomers BamHI (NEB, Beverly, MA) and BglII (NEB) to ligate both MIR497 and MIR34A into the vector to generate the expression construct Hi-miR497/34a, which was confirmed by DNA sequencing.
A clone of the green fluorescent protein (GFP)-tagged cDNA [including complete 3-UTR encoding human CCNE1 (NM_001238.2)], was bought from Origene (Rockville, MD) as transfection-ready plasmid DNA. The neomycin-resistance gene is expressed downstream from the SV40 promoter in the same vector, which permits the positive selection of transfected cells. To construct cells stably expressing CCNE1, A549 cells were transfected with the plasmid DNA and selected with neomycin (0.5 mg/mL).

The designed oligonucleotides were annealed, followed by ligation into the pcDNA6.2-GW/EmGFP-miR vector (Invitrogen), which facilitates transfer into a suitable destination vector via Gateway recombination reactions. The EmGFP forward sequence primer (5′- GGCATGGACGAGCTGTACAA -3′) was used for sequencing of the miRNA insert fragments, which was performed using an ABI PRISM^® 310 Genetic Analyzer. As the control, pcDNA6.2-GW/EmGFP-miR negative control plasmid (Invitrogen) was used. The sequence containing the miRNA coding region was transferred to the lentivirus vector via the Gateway cloning system (Invitrogen). Briefly, the miRNA coding region was subcloned into the entry plasmid pDONR221 (Invitrogen) using Gateway^® BP Clonase™ II Enzyme Mix (Invitrogen). The sequences in the entry plasmids were then transferred to the lentiviral expression vector, pCSII-EF-RfA, using Gateway^® LR Clonase™ II Enzyme Mix (Invitrogen).

Lentivirus vectors expressing mature let-7e, anti-miRNA-oligo of let-7e (AMO-let-7e) or NC sequence were constructed by Invitrogen (Invitrogen). Briefly, the precursor sequence of let-7e and its antisense fragment were synthesized by Invitrogen. The synthesized fragments were annealed and inserted into the pcDNA™ 6.2-GW/EmGFP-miR vector (Invitrogen). Then, lentivirus plasmid was constructed by BP and LR recombination into pLenti6.3/TO/V5-DEST vector (Invitrogen) through the Gateway recombination technology. The constructed pLenti6.3/TO/V5-DEST plasmid and an optimized mix of the three packaging plasmid (pLP1, pLP2 and pLP/VSVG; Invitrogen, China) were cotransfected into 293FT procedure cell line by liposome reagent to package lentivirus. The virus liquid was collected and concentrated 48 hrs after cotransfection, and the titre of the lentivirus liquid was determined.

siRNA sequences for CEMP1 (NM_001048212.3; GI:313677962) were designed using Invitrogen’s RNAi Designer. The synthesized complementary DNA oligos (Invitrogen, Carlsbad, CA, USA), were annealed to generate a double-stranded oligo and cloned into the linearized pcDNA 6.2-GW/EmGFP-miR vector (Invitrogen, Carlsbad, CA, USA), using T4 DNA ligase. The Neg-miRNA control plasmid was included in the Block-iT-Pol II miR RNAi Expression Vector Kit. All of the vectors were transformed into One Shot TOP10 Chemically Competent E. coli (Invitrogen, Carlsbad, USA), and the colonies containing spectinomycin-resistant transformants were further analyzed for the desired expression. The recombinant vectors were purified with a purification kit (Invitrogen, Carlsbad, USA) and confirmed by sequencing.