Total RNA was extracted using TRIzol reagent (Invitrogen, Beijing, China). First-strand cDNA were synthesized using oligo (dT) primers and MLV reverse transcriptase (TaKaRa Bio, Beijing, China). Quantitative real-time PCR was performed using SYBR Green mix (TaKaRa Bio, Beijing, China) and monitored with the 7500 RT qPCR system (Applied Biosystems, Foster City, CA, United States). The primers used for qPCR are listed in Supplementary Table 1 .
7500 rt qpcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States, China
The 7500 RT-qPCR System is a real-time PCR instrument designed for gene expression analysis. It utilizes fluorescence detection technology to accurately quantify target sequences in real-time during the amplification process. The system can accommodate 96-well reaction plates and provides consistent performance for a wide range of applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
Mlv reverse transcriptase, by Takara Bio (2 mentions)
Sybr green mix, by Takara Bio (2 mentions)
Rneasy plus mini kit, by Qiagen (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Takara Bio (2 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
First strand cdna kit, by Merck Group (1 mentions)
Sybr green, by Takara Bio (1 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions)
Superscript 4 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
Sybr green, by Thermo Fisher Scientific (1 mentions)
Taqman microrna assay, by Thermo Fisher Scientific (1 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Sybr green qpcr supermix, by Thermo Fisher Scientific (1 mentions)
Rnasimple total rna kit, by Tiangen Biotech (1 mentions)
Reverse transcription system, by Promega (1 mentions)
Sybr green premix, by Takara Bio (1 mentions)
Reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
19 protocols using 7500 rt qpcr system
1
Quantitative Gene Expression Analysis
2
Analyzing FGF10 and miR-9 Expression in AR42J Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from AR42J cells following incubation with TRIzol® reagent (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. RNA (1 µg) was reverse transcribed (denaturation at 65˚C for 15 min, followed by reaction at 25˚C for 10 min and 42˚C for 60 min, and denaturation at 99˚C for 5 min) using a first-strand cDNA kit (Sigma-Aldrich, Merck KGaA) according to the manufacturer's protocol. RT-qPCR was performed using cDNA, specific primers and SYBR™ Green (Takara Bio, Inc.) on a 7500 RT-q PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The thermocycling conditions were 95˚C for 5 min and 40 cycles, 95˚C for 15 sec and 60˚C for 1 min, followed by 72˚C for 5 min. The following pairs of rat RNA primers were used: FGF10 forward, 5'-AAGAACGGCAAGGTCAGC-3' and reverse, 5'-GAGGAAGTGAGCGGAGGTG-3'; GAPDH forward, 5'-GACATGCCGCCTGGAGAAAC-3' and reverse, 5'-AGCCCAGGATGCCCTTTAGT-3'; miR-9 forward, 5'-GCCCGCTCTTTGGTTATCTAG-3' and reverse, 5'-CCAGTGCAGGGTCCGAGGT-3'; and U6 forward, 5'-CTCGCTTCGGCAGCACA-3' and reverse, 5'-AACGCTTCACGAATTTGCGT-3'. FGF10 and miR-9 expressions were normalized to U6 or GAPDH, respectively and calculated according to the 2-ΔΔCq method (24 (link)). All experiments were performed in triplicate.
3
Vinculin Expression in Muscle Cells
4
Transcriptomic Analysis of Eugenol Response
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of rpmG, degP, rnpA, dapD, rcsB, rcsD, rcsA, yiaG, and yiaD genes at the mRNA level was selected from transcriptome sequencing and evaluated via RT-qPCR. Bacteria were prepared as mentioned in the “Transcriptome Sequencing” section. In the control group, LB broth was added instead of eugenol. The total RNA was extracted using the method as previously described and was then reversely transcribed to cDNA. Then, cDNA was used as a template for RT-qPCR amplification in the same reaction tube using PerfectStartTM Green RT-qPCR SuperMix. RT-qPCR was carried out in an Applied Biosystems 7500 RT-qPCR System (USA). The sequences of RT-qPCR primers used are shown in Table 2 . The amplifications were performed in 20 μl reaction mixtures containing 10 μl PerfectStartTM Green RT-qPCR SuperMix, 0.5 μl forward and reverse primer each, 8.0 μl nuclease-free water, and 1.0 μl template, respectively. 16SrRNA of the strain was used as a reference gene. The reaction condition was set as a two-step method as follows: one cycle at 94°C for 30 s, then 40 cycles consisting of denaturation were at 95°C for 5 s, and signal collection at 60°C for 34 s. All templates were run in triplicates.
5
RT-qPCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using RNeasy Plus Mini Kit (Qiagen) and 1 μg was reverse-transcribed using Superscript IV Reverse Transcriptase (Invitrogen). RT-qPCR was performed using TaqMan Gene Expression Assays (Applied Biosystems) on the 7500 RT-qPCR System (Applied Biosystems) with the probes listed in Supplementary data. Changes in mRNA expression levels were calculated relative to untreated control condition and normalized to Polr2a mRNA level using the 2–ΔΔCt formula.
6
Quantifying Upregulated miRNAs After Injury
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of significantly upregulated miRNAs identified by NGS analysis of the injury and recovery samples (n = 28 each) was determined by real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR). TaqMan MicroRNA Reverse Transcription Kits (Applied Biosystems, Foster City, CA, USA) were used to reverse transcribe the RNA into cDNA. Then, TaqMan Universal PCR Master Mix (No UNG, PN 4324018, Applied Biosystems) and specific miRNA primers from TaqMan MicroRNA Assays (Applied Biosystems) were used to amplify the cDNA. About 25 fmol single-stranded cel-miR-39 (Invitrogen) was added to each sample for use as an internal control to determine miRNA expression. RT-qPCR was performed using a 7500 RT-qPCR system (Applied Biosystems) and SYBR Green (Applied Biosystems). miRNA expression levels were quantified using the 2−ΔΔCt method using normalized cycle threshold (Ct) values. Beta-actin was used as the internal control. When the mean value of all the samples was different from that of its control by more than two-fold and p < 0.05, the change in miRNA expression was considered statistically significant.
7
Quantifying DLEU2, RAP1B, and miR-30a-5p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using TRIzol (Invitrogen, MA, USA) according to the manufacturer's instructions. Real-time mRNA quantification for DLEU2, miR-30a-5p, RAP1B, U6, and 18sRNA was performed using SYBR Green qPCR SuperMix (Invitrogen) on a 7500 RT-qPCR System (Applied Biosystems, MA, USA). PCR experiments were carried out under the following conditions: 95°C for 10 min, 55°C for 2 min, and 72°C for 2 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. The primers for DLEU2, RAP1B, miR-30a-5p, 18sRNA (as internal normalization control for DLEU2 and RAP1B), and U6 (as internal normalization control for miR-30a-5p) were as follows: DLEU2 forward, 5′-TCCTTCCCTGGAAGAGCACA-3′, and DLEU2 reverse, 5′-TTGGAGCTGCTATGCTTGTCA-3′; RAP1B forward, 5′-ACAGCGTGAGAGGTACTAGGT-3′, and RAP1B reverse, 5′-GTAAATTGCTCCGTTCCTGC-3′; miR-30a-5p forward, 5′-ACACTCCAGCTGGGTGTAAACATCCTCGAC-3′, and miR-30a-5p reverse, 5′-CTCAACTGGTGTCGTGGA-3′; 18sRNA forward, 5′-CCTGGATACCGCAGCTAGGA-3′, and 18sRNA reverse, 5′-GCGGCGCAATACGAATGCCCC-3′; and U6 forward, 5′-CTCGCTTCGGCAGCACA-3′, and U6 reverse, 5′-AACGCTTCACGAATTTGCGT-3′. Relative DLEU2, RAP1B, and miR-30a-5p expression levels were calculated using the 2−ΔΔCt method [20 (link)]. All RT-PCR experiments were repeated three times.
8
Quantitative Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the RNA simple Total RNA Kit (DP419, TIANGEN BIOTECH BEIJING CO., Ltd.). After checking the purity (1.8 < OD260/OD280 < 2.0) and concentration (1000–1500 ng/μL), total RNA was reverse transcribed into cDNA by using a Reverse Transcription System (Promega, Wisconsin, USA) according to the manufacturer's instructions. Then, the cDNA was subjected to quantitative real‐time PCR (RT‐qPCR) analysis on a 7500 RT‐qPCR System (Applied Biosystems, USA) with qPCR Mix (Promega, Wisconsin, USA). Using the SYBR Green method, amplification was completed under the following reaction conditions: 95°C for 2 min; denaturation at 95°C for 15 s; annealing and extension at 60°C for 1 min; and 40 cycles of melting at 95°C for 15 s, 60°C for 1 min, and 95°C for 15 s. All samples were run in triplicate, and the results were analysed with the 2−ΔΔCt method.
The primers used in this study are listed as follows:
The primers used in this study are listed as follows:
| CPNE7 | Forward, 5′‐GCAGAACCGAGGTGGTCC‐3′ Reverse, 5′‐TGCGTGTCGTACACCTCAAA‐3′ |
| ATG9B | Forward, 5′‐CAGGCACCAGGAAGCCAGAA‐3′ Reverse, 5′‐GCAGGAAACAAAGTCCACAAAGC‐3′ |
| GAPDH | Forward, 5′‐ GGACCTGACCTGCCGTCTAG‐3′ Reverse, 5′‐ GTAGCCCAGGATGCCCTTGA‐3′ |
9
Quantifying OsNPF2.2 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (TaKaRa, China). The first strand cDNAs were synthesized using oligo (dT) primers and MML reverse transcriptase (Promega. China). Specific semi-quantitative RT-PCR primers used to amplify OsNPF2.2 and eEF-1a were as follows: OsNPF2.2 forward, 5′-GCCGTCGCAGGAGCAAACT-3′; OsNPF2.2 reverse, 5′-CGAGGAGGAGGCACAAGGTG-3′; eEF-1a forward, 5′-AGCCGCTGAGATGAACAA-3′; and eEF-1a reverse, 5′-GAGATGGGAACGAAGGGA-3 ′. Quantitative real-time PCR (qPCR) was performed using SYBR Green Premix (TaKaRa) and monitored with the 7500 RT-qPCR system (Applied Biosystems,USA). The primers used for qPCR were as follows: OsNPF2.2 forward, 5′-GCAGGAGCAAACTAAGCT-3′; OsNPF2.2 reverse, 5′-TGGGGATGTGGAAGACGGT-3′, eEF-1a forward, 5′ -GCACGCTCTTCTTGCTTTC-3′; and eEF-1a reverse, 5′-AGGGAATCTTGTCAGGGTTG -3′.
10
Quantifying mRNA Expression of Cx43 and DSG2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse-transcription polymerase chain reaction (RT-qPCR) was performed to quantify the mRNA expression levels of Cx43, DSG2. Total RNA was extracted with TRIzol reagent (Life Technologies, USA), according to the instructions of the manufacturer. Reverse transcriptase (Thermo Fisher Scientific, USA) was used for reverse transcription, and RT-qPCR was performed using a Quantitect SYBR Green PCR Kit (Qiagen, Germany) in a 7500 RT-qPCR System (Applied Biosystems, Foster City, CA, USA) using 7500 software (Version 2.3). GAPDH was used as an internal reference. The quantitative expression results were calculated using the 2-∆∆Ct method. All primer sequences of tested genes are presented in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!