Abi 7700 sequence detection system

HepG2.2.15 cells were seeded into the wells of a 6-well culture plate and allowed to grow until 80% confluence. Subsequently, these cells were treated with the dsRNA (10 μg/mL) and PBS (negative control), respectively. After treatment at 37°C for 24 hours, total RNA was isolated from HepG2.2.15 cells using TRIzol (Invitrogen, Carlsbad, CA). qRT-PCR was performed for TLR3, HBsAg, and HBcAg using an ABI 7700 Sequence Detection System (Applied Biosystems). Cycling conditions for amplification were 95°C for 3 min; 35 cycles at 95°C for 45 sec, 60°C for 45 sec, and 72°C for 30 sec; and, finally, 72°C for 7 min. The primers are listed in Table 1. Each human gene expression was normalized to GAPDH mRNA copies from the same sample.

mRNA was extracted from C26GM cultured cells using RNAeasy kit (Qiagen). cDNA was obtained by reverse transcription of mRNA with random hexamers and ThermoScript RT-PCR system (Life technologies) according to the manufacturer instructions. qPCR was performed on cDNA to amplify Cx26, Cx30, Cx30.3, Cx40, Cx43 and was normalized to GAPDH expression. Amplification was carried out using SYBR Green (Applied Biosystems) on the ABI 7700 sequence detection system equipped with ABI Prism 7700 SDS software (Applied Biosystems) through the following amplification cycles: 50°C: 2 min, 95°C: 10 min, 95°C: 15sec, 60°C: 1 min (40 cycles). For real-time PCR the following primers were used: Cx26f: 5′−CGG AAG TTC ATG AAG GGA GAG AT −3′; Cx26r: 5′−GGT CTT TTG GAC TTT CCT GAG CA −3′; Cx30f: 5′− GTC ATC GGT GGC GTG AAC AAG CAC −3′; Cx30r: 5′− GAG CAG CAT GCA AAT CAC GGA TGC −3′; Cx30.3f: 5′− TCA AAC ATG GGC CCA ATG −3′; Cx30.3r: 5′− GGG AGT CAC AGA GCA AGC −3′; Cx40f: 5′− CTG TCC CCA CCC AGT CAA CT −3′; Cx40r: 5′− CCG TTT GTC ACT ATG GTA GC −3′; Cx43f: 5′− TAC CAC GCC ACC ACC GGC CCA −3′; Cx43r: 5′− GGC ATTTTGGCTGTCGTCAGGGAA −3′; GAPDHf: 5′−ATG TGT CCG TCG TGG ATC TGA C−3′; GAPDHr: 5′−AGA CAA CCT GGT CCT CAG TGT AG−3′.
Quantification of connexin mRNA expression relative to GAPDH was performed using the ΔΔCT method.

A549-shRNA cells and A549-NC cells were seeded and harvested after culture 96h. Total RNA was extracted from each group of cells using the Trizol (Invitrogen), cDNA synthesis was obtained using the ThermoScript^TM Reverse Transcriptase kit (Life Technologies), then, RT-PCR was performed using Power SYBR^® Green PCR Master Mix (Life Technologies). The mRNA expression of various genes was assessed using ABI 7700 Sequence Detection System (Applied Biosystems). Relative gene expression was quantified.