Non target control sirna

Sequence-specific ON-TARGETplus siRNA for human RAD51 (catalog number J-003530-09-0002 and Ku80 (catalog number J-010491-05-0002), and non-target control siRNA (catalog number D-001830-01-05) sequences were used for this study (Dharmacon, Lafayette, CO). For overexpression studies, pCMV-6 vector (Myc-DDK-tagged, catalog number PS100001), or Myc-DDK tagged RAD51 (catalog number RC218333) or Myc-DDK tagged Ku80 (catalog number RC510649) expression plasmids were obtained from Origene (Rockville, MD). Cells were seeded in six-well plates (for Western blotting and annexin V/PI analysis) and allowed to reach 70–80% confluence. Logarithmically growing glioma cells were transfected as described previously.^{22 (link)} After 48 h post-transfection, medium was changed and cells were incubated with inhibitors for the indicated period. Cell viability (annexin V/propidium iodide binding) or Western blot analysis were carried out as described above.

VHL was silenced using ON-TARGET plus Human VHL or non-Target control siRNA (Dharmacon). Cells were transfected using Lipofectamine 2000 (Invitrogen) according to manufacturers’ protocol. 24 hours after transfection cells were treated with either BMS 2.5μM (Selleck chemicals) or DMSO for 24 hours and then fresh media with inhibitor were added and cells were incubated in either normoxia or hypoxia for 24 hours. Lysates were collected with 2X Laemmli buffer.

RAW264.7 and J774, murine macrophage cell lines was maintained in RPMI medium supplemented with 10% heat-inactivated FBS, and antibiotics (penicillin at 100 IU/ml streptomycin at 100 μg/ml). Cells were cultured at 37°C in a humidified atmosphere containing 5% CO₂. CD16 silencing was done using SMARTpool ON-TARGETplus CD16 siRNA, and non-target control siRNA (Dharmacon) was used as control. Transfections were performed using INTERFERin (Polyplus, New York, NY) with siRNA (1 nM), following manufacture’s protocol. To knockdown CD16 protein expression siRNA transfection was done twice, the second transfection was done 48-h after the first transfection. Knockdown efficiency for mRNA and protein expression was confirmed by qRT-PCR and FACS analyses respectively. CD16 primers (sense, cgaaggaaccgccaagtg; anti-sense, ctagagcaagcgatgacagg) were used to determine CD16 knockdown. CD36, SR-A, LOX-1, β-actin and GAPDH primer assays were purchased from SA-Biosciences.