Taqman gene expression assay system

Total RNA was isolated from flash frozen brain punches using the RNeasy Plus Mini kit from Quiagen. RNA samples were reverse transcribed to single-stranded cDNA. cDNA transcription was used following the protocol from Superscript III (Life Technologies) and the TaqMan Gene Expression Assay system (Applied Biosystems). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH, Hs02758991_g1) was used as a housekeeping gene. The threshold cycle (CT) of each target product was determined and CT values between HDAC6 transcripts and housekeeping genes were calculated (ΔCT). The fold change (2^{- ΔΔCT}) for each was calculated relative to the median ΔCT from the saline control animals.

TSP-1 mRNA levels in peripheral blood mononuclear cells (PBMCs) were analyzed by quantitative RT-PCR following extraction of total RNA from patients’ whole blood samples collected in PAXgene Blood RNA kit (Qiagen, cat # 762164). Briefly, RNA was extracted using PAXgene Blood RNA kit according to the manufacturer’s instruction. For cDNA synthesis, RNA to cDNA EcoDry Premix (Takara, cat# 639548) was used. cDNA synthesis was performed by MiniAmp Thermal Cycler detection system (Applied Biosystems). PCR was conducted on the QuantStudio 6 Pro (Applied Biosystems) according to the manufacturer’s protocol. The TaqMan gene expression assay system (Applied Biosystems) was used for quantifying the levels of TSP-1 and GAPDH. The Sequence Detection system QuantStudio6 Pro (Applied Biosystems) was used to analyze amplification plots. The relative quantity of amplified cDNA was calculated by interpolating an average of four replicate Ct values onto a standard curve of Ct values obtained from serially diluted cDNA and normalized for expression of GAPDH. Four independent qPCR results were analyzed for each sample, standard deviations were calculated.

Analysis of mRNA expression of the genes of interest was performed by reverse
transcription semi-quantitative polymerase chain reaction (qRT-PCR) in a
StepOnePlus™ thermocycler (Applied Biosystems) with the TaqMan® gene expression
assay system (Applied Biosystems). The probes and primers for the genes (rats)
C5ar1 (Rn02134203_s1), Icam1 (Rn00564227_m1), Nos2 (Rn 00561646_m1), and Vegf-a
(Rn01511602_m1) and for the endogenous control Actb (Rn 00667869_m1) were
purchased from Applied Biosystems. qRT-PCR was performed in duplicate for each
sample using 10 μL TaqMan® Universal Master Mix II 2X, 1 μL TaqMan® Gene
Expression Assay 20×, and 4-μL diluted cDNA (1:5 dilution) for a final volume of
20 μL in 96-well plates coated with optical sealant. The reaction conditions
were 50°C for 2 min, 95°C for 10 min, 40 cycles at 95°C for 15 s, and 60°C for 1
min.
The expression level of each target gene was calculated by GenEx Standard 6.1
(MultiD Analyses AB, Göteborg, Sweden), which uses the 2^-ΔΔCt method
for relative quantification, in which:
Ct (threshold cycle) = the point at which amplification reaches the logarithmic
phase;
ΔCt = the difference in expression between the target gene and endogenous control
of a given sample;
ΔΔCt = the difference between the ΔCt of the sample and the ΔCt of the
control.

To detect miRNA, first-strand cDNA was synthesized from total RNA using the Mir-X miRNA First-Strand Synthesis Kit according to the protocols of the manufacturer (Takara, Kyoto, Japan). The cDNA generated was used as a template in real-time PCR with SYBR Premix EXTaq (Takara) and run on a Thermal Cycler DICE real-time PCR system (Takara). The forward primer used for the detection for miR-31 was 5′- AGGCAAGATGCTGGCATAGCT (mature miR-31, MIMAT0000089). The reverse primer was the universal mRQ 3′ primer (Takara). The primer set used to detect U6 snRNA was purchased from Takara Bio Inc. MiR-31 level was normalized to U6 snRNA levels. To detect mRNA, first-strand cDNA was synthesized from total RNA using the SuperScript III First-Strand Synthesis System (Invitrogen). The cDNA generated was used as a template in real-time PCR with TaqMan Gene Expression Assay system (Applied Biosystems, Foster City, CA) and run on a Thermal Cycler DICE real-time PCR system (Takara). The TaqMan probes and primer set used to detect GAPDH [NM_002046.5], ITGA5 [NM_002205.2], MMP16 [NM_005941.4], and RHOA [NM_001664.2], was customized and purchased Applied Biosystems. ITGA5, MMP16, and RHOA levels were normalized to GAPDH levels.