Lentivirus expression vectors encoding full-length human FAF1 (Lenti-FAF1) and empty control vector (Lenti-NC) were synthesized by Shanghai GeneChem (Shanghai, China). Constructs for RNA interference (RNAi) targeting the human NF-κB p65 subunit mRNA (GenBank, NM_021975) or human NF-κB IKKβ subunit mRNA (GenBank, NM_001190720) were also synthesized by Shanghai GeneChem. As a negative RNAi control, a random non-coding RNA was synthesized (5′-TTC TCC GAA CGT GTC ACGT-3′).
Lenti nc
Manufactured by Genechem
Sourced in China
Lenti-NC is a lentiviral vector system for the generation of non-coding RNA. It provides a platform for the stable expression of small interfering RNA (siRNA), microRNA (miRNA), or other non-coding RNA sequences in target cells.
Automatically generated - may contain errors
Lab products found in correlation
Agomir nc, by RiboBio (2 mentions)
Mimics nc, by RiboBio (1 mentions)
Mir 34a inhibitor, by RiboBio (1 mentions)
Mir 34a mimic, by RiboBio (1 mentions)
Gapdh, by Merck Group (1 mentions)
X tremegene sirna transfection reagent, by Roche (1 mentions)
Puromycin, by Genechem (1 mentions)
Polybrene, by Genechem (1 mentions)
Transwell chamber, by Corning (1 mentions)
Mccoy 5a, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Rpmi 1640, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
Dmem f12, by Thermo Fisher Scientific (1 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
β actin, by Cell Signaling Technology (1 mentions)
Dual luciferase reporter system, by Promega (1 mentions)
T4 dna ligase, by New England Biolabs (1 mentions)
10 protocols using lenti nc
1
Lentiviral Overexpression and Knockdown of NF-κB Pathway
2
Modulating miR-34a Expression in Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Six synthetic, chemically modified short single or double stranded RNA oligonucleotides (miR-34a mimics, mimics NC, miR-34a inhibitor, inhibitor NC, agomir-miR-34a and agomir-NC) were purchased from Ribo Biotech (Guangzhou, China). Agomir-miRNA is a chemically modified miRNA mimics conjugated with cholesterol. Prevalidated siRNA specific for CD44 and a nonsilencing siRNA control were purchased from Genepharma Biotech (Shanghai, China). Lenti-miR-34a and Lenti-NC were purchased from Genechem Biotech (Shanghai, China) Primary antibody CD44 (1:1000) and GAPDH (1:10000) were purchased from Sigma-Aldrich, St. Louis, MO. Oligonucleotide and plasmid transfection was done by using X-tremeGENE siRNA Transfection Reagent (Roche) and FuGene HD Transfection Reagent (Roche) respectively, according to the manufacture’s protocol. The lentivirus infection was carried out according to the manufacture’s protocol and he MOI for 5637, T24 and HT1376 cells was 10, 10 and 5 respectively.
3
Lentiviral knockdown of NogoB in HRMECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Both Lenti-NogoB-RNAi and Lenti-NC were constructed and producted by Genechem (Shanghai, China). 2 × 10 5 HRMECs were plated in each well of a 6-well-plate. When the cells reached 20% to 30% confluence, lentiviral vector expressing siRNA-NogoB (5'-3': CACAGAAUCUAUGGACUGAAU) and negative control (5'-3': UUCUCCGAACGUGUCACGUTT) was added (MOI=10) with 50 μg/mL Polybrene (Genechem, Shanghai, China). After incubation for 8 hours, the media replaced with complete culture media. Transduced cell clones were selected with 3 μg/mL puromycin (Genechem, Shanghai, China) for 2 weeks, and cells were expanded in complete culture medium.
4
Inhibition of miR-17-5p Attenuates CCl4-Induced Liver Injury
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lentiviral vector containing negative control (Lenti-NC) and lentiviral miR-17-5p inhibitor (Lenti-miR-17-5p-inhibitor) were obtained from Shanghai GeneChem. Rats were treated with olive oil (n = 6), CCl4 (n = 6), CCl4 plus Lenti-NC (n = 6) and CCl4 plus Lenti-miR-17-5p-inhibitor (n = 6). Lenti-miR-17-5p-inhibitor or Lenti-NC was injected via the tail vein only once at three weeks after CCl4 injection (1×109 transducing unit/rat). After the following 3-weeks CCl4 treatment, the rats were sacrificed.
5
Comprehensive Cell Culture Reagents Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
McCoy 5A, RPMI 1640, DMEM and DMEM/F-12 were purchased from Gibco (Grand Island, NY, USA). Restriction endonucleases and T4 DNA ligase were from New England Biolabs (Ipswich, MA, USA). The dual-luciferase reporter system and the empty psiCHECK-2 vector were purchased from Promega (Madison, WI, USA). Lipofectamine 2000 and Trizol reagent were obtained from Invitrogen (Carlsbad, CA, USA). TaqMan microRNA Reverse Transcription kits and TaqMan gene expression assays were from Applied Biosystems (Carlsbad, CA, USA). miR-103 precursors and inhibitors, scramble miRNA negative control were purchased from Ambion (Carlsbad). Lenti-miR-103 and Lenti-NC were from Genechem Biotech (Shanghai, China). Agomir-miR-103 and agomir-NC (miRNA mimics conjugated with cholesterol to make it more stable) were from Ribo Biotech (Guangzhou, China). Primary antibodies for DICER, PTEN and β-actin were purchased from Cell Signaling Technology (Beverly, MA, USA). Nucleotides were synthesized by TaKaRa (Shanghai, China). Transwell chambers were purchased from Costar (Cambridge, MA, USA).
6
Lentiviral Delivery of miR-19a/b in Gastric Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lentiviral system with EGFP-expressing miR-19a (lenti-miR-19a) and miR-19b (lenti-miR-19b) and the negative control lenti-vector (lenti-NC) were purchased from Genechem (Shanghai Genechem Co., Ltd, Shanghai, China). Gastric cancer cell lines SGC7901, SGC7901Luc and MKN28 were infected with lenti-miR-19a, lenti-miR-19b or lenti-NC, according to the manufacturer's instructions, and stable cells were isolated by flow cytometry to sort EGFP-positive cells using flow cytometry.
7
Western Blot Analysis of EMT Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
UBE2C, AURKA, β-catenin, AKT1, p-AKT1, GSK-3β, p-GSK-3β, Slug, Snail and Twist antibodies were purchased from Abcam (Cambridge, UK). E-cadherin, N-cadherin and p-AURKA antibodies were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). The GAPDH antibody was purchased from Zhongshan Golden Bridge Biotechnology (Beijing, China). Western blot analysis reagents were purchased from Sigma, PVDF membranes were purchased from Millipore Corp. (Bedford, MA, USA) and RIPA lysis buffer was purchased from Beijing Taike Biotechnology. Lentiviruses containing an UBE2C and AURKA inhibitor sequences (Lenti-si-UBE2C and Lenti-si-AURKA) or negative control (Lenti-NC) were obtained from Shanghai GeneChem Co., Ltd. (Shanghai, China).
8
Generation of IL-6 Overexpressing Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate cell lines overexpressing IL-6, the human IL-6 cDNA sequence (Genebank accession number: NM_000600) was searched for suitable target sequences. Lenti-IL-6-GFP and Lenti-NC virus were designed and generated by Gene-Chem Co., Ltd (Shanghai, China). DNA oligos containing the target sequence (forward primer: AGGTCGACTCTAGAGGATCCCGCCACCATGAACTCCTTCTCCACAAG, reverse primer: TCCTTGTAGTCCATACCCATTTGCCGAAGAGCC) were inserted into the GV492 vector by double digestion with BamHI and AgeI. PC-9 cells, PC-9GR cells, and HCC827 cells were transfected with ViraPower packaging mix using Lipofectamine 2000 reagent according to manufacturer’s instructions. Increased IL-6 levels in these generated cells were confirmed by ELISA.
9
Lentiviral Transduction of Lung Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lenti-PIK3CA (H1047R)-GFP, Lenti-PIK3CG (L468M)-GFP, and Lenti-NC viruses were purchased from Gene-Chem Co., Ltd. (Shanghai, China). HCC827, H3255, PC-9, PC-9GR, Ba/F3-EGFRDel19, and Ba/F3-EGFRDel19-T790M cells were transfected with ViraPower packaging mix using Lipofectamine 3000 reagent (Invitrogen, USA) based on the manufacturer’s instructions.
10
Lentiviral Transduction and LPS Treatment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lenti-NC and Lenti-PICK1 were built at Shanghai Genechem Co., Ltd. (Shanghai, China). HK2 cells were seeded into 6-well plates. When the cell fusion reached 50%, the medium containing lentivirus and HitransG A was added. After 24 hours of incubation, the medium was changed, and the cells were cultured for another 24 hours for further analysis. Besides, stably transfected cell lines were screened by puromycin (2 ng/ml). Then, cells were cultured with the optimum concentration of LPS for the given time.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!