The largest database of trusted experimental protocols

28 protocols using pcd5 cir vector

1

Modulating CircRNA_0010220 Regulatory Network

Check if the same lab product or an alternative is used in the 5 most similar protocols
Circ_0010220 overexpression vector was constructed by Geneseed (Guangzhou, China) based on the pCD5-ciR vector (Geneseed), and the pCD5-ciR vector alone was used negative control (circ-NC). STX6 overexpression vector was constructed via Genomeditech (Shanghai, China) with the pcDNA3.1 vector (Genomeditech) as negative control (pcDNA). Small interfering RNA (siRNA) for circ_0010220 (si- circ_0010220#1, si-circ_0010220#2 and si-circ_0010220#3), siRNA negative control (si-NC), miR-198 mimic, miR-198 inhibitor (anti-miR-198), and negative control (NC or anti-NC) were generated by Ribobio (Guangzhou, China). The oligonucleotide sequences were exhibited in Table 1. HOS and U2OS cells were transfected with 1 μg vectors or 30 nM oligonucleotides using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA) for 24 h. 24, 48 or 72 h upon transfection, cells were collected for further research.

The oligo sequences for transfection in this study.

NameSequence (5’-3’)
si-circ_0010220#1UACACACUCCAAGUCCAGAUG
si-circ_0010220#2UCCCAGCUACACACUCCAAGU
si-circ_0010220#3CACACUCCAAGUCCAGAUGUA
si-NCAUGUGACUCCAAGUCCAGAUG
miR-198 mimicGGUCCAGAGGGGAGAUAGGUUC
NCCGAUCGCAUCAGCAUCGAUUGC
anti-miR-198GAACCUAUCUCCCCUCUGGACC
anti-NCCUAACGCAUGCACAGUCGUACG
+ Open protocol
+ Expand
2

Regulation of Chondrocyte Homeostasis

Check if the same lab product or an alternative is used in the 5 most similar protocols
For circ_0020093 overexpression, circ_0020093 sequence was cloned into pCD5-ciR vector (Geneseed, Guangzhou, China), naming as circ_0020093, with pCD5-ciR vector as a comparison. Small interference RNA targeting circ_0020093 or SPRY1 (si-circ_0020093 or si-SPRY1) and matched control (si-con) were synthesized by Ribobio (Guangzhou, China). The inhibitors and mimics of miR-23b (miR-23b and in-miR-23b), as well as matched controls (miR-con and in-miR-con) were obtained from Ribobio.
These plasmids and oligonucleotides were transfected into chondrocytes alone or together using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) following the statement from protocol.
+ Open protocol
+ Expand
3

Chondrocyte Isolation and Inflammation Modeling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chondrocytes were isolated and cultured as previously described.21 (link),22 (link) For OA model, arthritic chondrocytes at 70% confluence were stimulated with determined concentrations (5, 10 and 15 ng/ml) of human IL-1β recombinant protein for 48 h; cells without IL-1β stimulation served as control.
Short hairpin RNA (shRNA) targeting circ_0000205 (sh-circ_0000205), miR-766-3p mimic (miR-766-3p), miR-766-3p inhibitor (anti-miR-766-3p), and counterpart negative controls (NCs) including sh-NC, miR-NC and anti-miR-NC were all obtained from GenePharm (Shanghai, China). The intact sequence of circ_0000205 and coding domain sequence of ADAMTS5 were separately cloned into pCD5-ciR vector (GENESEED, Guangzhou, China) and pcDNA (zeo+) vector (BioVector Science Lab, Beijing, China) to construct circ_0000205 overexpression plasmid and ADAMTS5 overexpression vector. Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA, USA) kit was used to transfect according to the manufacturer's instructions. Transfected cells at 48 h were collected for gene expression analysis or for 10 ng/mL of IL-1β administration for 48 h for functional experiments.
+ Open protocol
+ Expand
4

Overexpression of circ-SMARCA5 in HuH-28 and TFK-1 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pCD5‐ciR vector (Geneseed Biotech Co., Ltd) was used to structure circ‐SMARCA5 overexpression (OE) plasmid and control OE plasmid. After construction, the OE plasmids were transfected into HuH‐28 cells and TFK‐1 cells using Lipofectamine 2000 (Thermo); then, the cells transfected with circ‐SMARCA5 OE plasmids were marked as OE‐Circ group; and correspondingly, the cells transfected with control OE plasmids were termed as OE‐Control group. After transfection, cell proliferation in both groups was measured at 0, 24, 48, and 72 hours using Cell Counting Kit‐8 (Sigma), and the procedure was in accordance with manufacturer's manual.
+ Open protocol
+ Expand
5

Modulating Circular RNA Expression in Oral Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
pGPH1 vector was applied to construct hsa_circ_0002162 knock-down plasmid and circRNA control knock-down plasmid by GenePharma Co., Ltd (China). pCD5-ciR vector was applied to construct hsa_circ_0002162 overexpression plasmid and circRNA control overexpression plasmid by Geneseed Biotech Co., Ltd. (China). Hsa_circ_0002162 knock-down plasmid and circRNA control knock-down plasmid were transfected into CAL-27 cells using HilyMax (Dojindo, Japan), and the cells were divided into Circ(-) cells and NC(-) cells, accordingly. Hsa_circ_0002162 overexpression plasmid and circRNA control overexpression plasmid were transfected into SCC-9 cells using HilyMax (Dojindo), and the cells were divided into Circ(+) cells and NC(+) cells, accordingly. The expression of hsa_circ_0002162 in the four cell lines was evaluated by RT-qPCR at 24 h post transfection.
+ Open protocol
+ Expand
6

Overexpression and Silencing of circCRKL and p27

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pCD5‐ciR vector (Geneseed, Guangzhou, China) was used for circCRKL overexpression. The human p27 cDNA was synthesized and inserted into pcDNA3.1 by Vigene (Shandong, China). The shRNAs against circCRKL and p27 were designed and cloned into pGPU6-GFP-Neo (GenePharma, Shanghai, China). The miR-196a-5p/miR-196b-5p mimics, negative control (miR-NC), and anti-miR-196a-5p/anti-miR-196b-5p inhibitor were purchased from RiboBio (Guangzhou, China). The transfection was performed with lipofectamine 3000 reagent (Invitrogen, CA, USA, Cat no. L3000015) as previously described [17 (link)]. The detailed sequences are provided in Table S2.
+ Open protocol
+ Expand
7

Circular RNA Overexpression and Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human hsa_circ_0009035 sequence, the hsa_circ_0009035 sequence lacking the mniR-889-3p binding sites, and a nontarget control sequence were synthesized by BGI (Shenzhen, China) and individually inserted into a pCD5-ciR vector (Geneseed, Guangzhou, China) opened with EcoRI and BamHI sites to produce an hsa_circ_0009035 overexpression plasmid, a mutant hsa_circ_0009035 overexpression plasmid (MUT-hsa_circ_0009035), and a negative-control plasmid (pCD5-ciR). Human HOXB7 (accession no. NM_004502.4; synthesized by BGI) was cloned into a pcDNA3.1 vector (Invitrogen, Saint-Aubin, France) with BamHI and XhoI restriction sites to construct HOXB7 overexpressing plasmid, and a nontarget pcDNA3.1 plasmid (pcDNA) was used as the negative-control plasmid. A mature miR-889-3p mimic (5′-UUAAUAUCGGACAACCAUUGU-3′), a mimic negative control (miR-NC mimic; 5′-ACGUGACACGUUCGGAGAATT-3′), an miR-889-3p inhibitor designed for miR-889-3p silencing (anti-miR-889-3p; 5′-ACAAUGGUUGUCCGAUAUUAA-3′), and the scrambled oligonucleotide control (anti-miR-NC; 5′-CAGUACUUUUGUGUAGUACAA-3′) were obtained from Ribobio (Guangzhou, China). HeLa and Siha cells at ∼60% confluence in 24-well plates were transiently transfected with 200 ng of plasmids and 50 nM oligonucleotides using Lipofectamine 3000 as recommended by the manufacturer (Invitrogen). Cells were harvested for further experiments after 48 h.
+ Open protocol
+ Expand
8

Evaluating Doxorubicin Sensitivity in Breast Cancer Cells Overexpressing circ-LARP4

Check if the same lab product or an alternative is used in the 5 most similar protocols
The circ‐LARP4 overexpression plasmid was constructed using pCD5‐ciR vector (Geneseed), and then, the overexpression plasmid was transfected into MCF‐7 and MDA‐MB‐231 cells using HilyMax (Dojindo). Meanwhile, a control overexpression plasmid was also constructed and transfected into MCF‐7 and MDA‐MB‐231 cells as the method described above. The cells transfected with circ‐LARP4 overexpression plasmid were defined as OE‐Circ group, and the cells transfected with control overexpression plasmid were defined as OE‐Control group. After transfection for 48 hours, both OE‐Circ cells and OE‐Control cells were treated with different concentrations of doxorubicin for additional 48 hours. Then, Cell Counting Kit‐8 (CCK‐8, Dojindo Molecular Technologies) was used to determine the viability of cells incubated with different concentrations of doxorubicin. The procedures were performed according to the manufacturer's manual. The relative cell viability was calculated referring the viability of cells treated by 0 nmol/L doxorubicin in each group. Finally, the doxorubicin concentration required to inhibit growth by 50% (IC50) value was estimated by Probit regression analysis using SPSS 24.0 software (IBM).
+ Open protocol
+ Expand
9

Cloning of Goat circRNA8220

Check if the same lab product or an alternative is used in the 5 most similar protocols
Goat circRNA8220 full length was obtained by PCR and inserted into pMD™19-T vector. Thereafter, the sequence was subcloned into the pCD5-ciR vector (Geneseed, Guangzhou, China) between EcoRI and BamHI sites. The forward primer of circRNA8220 was (EcoRI) 5′-CGGAATTCTAATACTTTCAGCTGGAGCTGATTGGACACAAT-3′ the reverse primer was (BamHI) 5′-CGGGATCCAGTTGTTCTTACCTCTCATCACAGTAGGTGAAC-3′.
+ Open protocol
+ Expand
10

Downregulation of circUHRF2, METTL3, and DDX27

Check if the same lab product or an alternative is used in the 5 most similar protocols
Short hairpin RNAs (shRNAs) against circUHRF2, METTL3, and DDX27 were provided by GenePharma (Shanghai, China). The sequences for shRNAs were shown as follows: sh-circUHRF2-1: 5′-GTATGATGATTGGAAAATGGA-3′; sh-circUHRF2-2: 5′-GATGATTGGAAAATGGATATA-3′; sh-METTL3-1: 5′-GCCTTAACATTGCCCACTGAT-3′; shMETTL3-2: 5′-GCAAGTATGTTCACTATGAAA-3′; sh-DDX27-1: 5′-GCAGAGGAAAGGTCTCAGTTT-3′; sh-DDX27-2: 5′-GCAGGAATTTGACTTGGCCTT-3′; sh- negative control (NC): 5′-TTCTCCGAACGTGTCACGT-3′. The full-length sequences of the circUHRF2 gene (circBase ID: hsa_circ_0002359) were inserted into the pCD5-ciR vector (GENESEED, Guangzhou, China) to establish the circUHRF2 over-expression plasmid. CRC cells were transfected with these segments using Lipofectamine 3000 (Thermo Fisher), according to the user’s guide. For transient transfection assay with shRNAs and plasmids, cells were harvested at 48 h for further experiments. For animal experiments, SW620 cells were stably infected with lentiviruses carrying sh-METTL3 or sh-circUHRF2 (GenePharma) in the presence of 8 μg/mL polybrene (GenePharma). Stably transfected or infected cell clones were chosen by appropriate antibiotics (puromycin, 2–5 μg/mL, Sigma, Saint Louis, MO, USA) for at least one week after virus infection or plasmid transfection.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!