Pcdh cmv mcs ef1 puro

The coding sequences of human GFPT2 or YBX1 were cloned and inserted into the lentiviral vector pCDH-CMV-MCS-EF1-puro (SBI, USA) to generate GFPT2 or YBX1 expression plasmids and then lentivirus-infected pancreatic cancer cells. For shRNA, pLKO.1 puro was used to generate GFPT2 knockdown pancreatic cancer cells. The sequences of shGFPT2 were as follows: shGFPT2#1: 5′- GGTTGAACTTGCTAGTGAT -3′; shGFPT2#2: 5′- AGGTAACTTCAGTGCGTTTAT -3′. For IL-18 and YBX1 interference, the target sequences of the siRNAs were as follows: siIL-18#1: 5′- GAAUCUAAAUUAUCAGUCA -3′; siYBX1#1: 5′- GGAGGCAGCAAATGTTACA -3′. Pancreatic cancer cells were transfected with siRNAs using Lipofectamine 3000 reagent (Life Technologies, Invitrogen) according to the manufacturer’s instructions.

The TRC cloning vector (pLKO.1; Addgene, Cambridge, USA) was utilized to construct shRNA plasmids against KLF5 according to standard protocols
[28] (link). Targets (21 bp) against
KLF5 were 5′-CCTATAATTCCAGAGCATAAA-3′ and 5′-GCTGTAATGTATATGGCTTTA-3′. pLKO.1-shKLF5, psPAX2, and pMD2.G were cotransfected into HEK-293T cells at a ratio of 4:3:1 to generate lentiviral particles. The coding sequences of human BRCA1 were cloned and inserted into the lentiviral vector pCDH-CMV-MCS-EF1-puro (SBI, San Francisco, USA) to generate BRCA1 expression plasmids.

For the circRNA expression vector (p‐circARHGAP35), the genomic region for circARHGAP35 was amplified from HEK293T genomic DNA using PrimerSTAR Max DNA Polymerase Mix (Takara) and cloned into circular RNA expression plasmid PLCDH‐ciR (Geenseed Co, Ltd, Guangzhou, China). p‐circARHGAP35‐Flag was derived by inserting 3 × Flag sequence immediately to the upstream of stop codon of circARHGAP35. The circARHGAP35 ORF sequence or mutatant sequence (the stop codon TGA was deleted) was amplified and cloned into pCDH‐CMV‐MCS‐EF1‐Puro (SBI, Palo Alto, CA, USA) to generate p‐lin‐cORF‐Flag and p‐lin‐cORF‐Flag‐mut. p‐lin‐FL was produced by inserting a full length of ARHGAP35 ORF sequence into pCDH‐CMV‐MCS‐EF1‐Puro vector. The gRNA sequence targeting ARHGAP35 were designed and cloned into lentiGuide‐puro vector (a generous gift from Dr. Feng Zhang). pcDNA5‐FTO‐HA was a generous gift from Dr. Zefeng Wang. pTRIPZ‐circARHGAP35‐ORF was constructed by inserting the Flag‐tagged circARHGAP35 ORF sequence into the pTRIPZ vector (Open Biosystems, Huntsville, USA), a Tet‐On lentiviral expression vector. The two HNRNPL binding sites sequences were synthesized (GENEWIZ, Suzhou, China), and together with the GFP sequence were cloned into pCDH‐CMV‐MCS‐EF1‐Puro vector. The primers are all listed in Table S3, Supporting Information. All constructs were verified by sequencing.