Transscript all in one first strand cdna synthesis kit

Manufactured by Transgene

Sourced in China

The TransScript All-in-One First-Strand cDNA Synthesis kit is a laboratory equipment product used for the conversion of RNA to complementary DNA (cDNA). It provides a single-tube solution for the reverse transcription of RNA to cDNA.

Automatically generated - may contain errors

Lab products found in correlation

16 protocols using transscript all in one first strand cdna synthesis kit

Quantifying HSPC111 and YAP1 mRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells and the 30 pairs of frozen tissue specimens using Trizol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized using the TransScript All-in-One First-Strand cDNA Synthesis kit (TransGen Biotech), according to the manufacturer's protocol. mRNA levels were determined with the Fast Start Universal SYBR Green Master mix (Takara Bio, Shiga, Japan). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA was used as the internal control. Primers were as follows:
HSPC111; 5′-GCGTCTGAACCGGAATGCTC-3′ (forward) and 5′-CCAGGTTCTGCCGTACCGAT-3′ (reverse); YAP1: 5′-CAGGAGCCCTGACTCCACAG-3′ (forward) and 5′-TTGCCATCTCCCAACCTGCT-3′ (reverse); GAPDH: 5′-CAGGGCTGCTTTTAACTCTGG T-3′ (forward) and 5′-GATTTTGGAGGGATCTCGCT-3′ (reverse). Amplification was conducted under the following conditions: denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 30 s. Experiments were performed in triplicate. Relative expression levels of HSPC111 were calculated using the 2^−ΔΔCT method.

Huang S., Zhu L., Cao Y., Li L., Xie Y., Deng J, & Xiong J. (2017). Significant association of YAP1 and HSPC111 proteins with poor prognosis in Chinese gastric cancer patients. Oncotarget, 8(46), 80303-80314.

+ Open protocol

+ Expand

Plant RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated by using plant RNA extraction kits (ER301; TransGen Biotech, China), and the complementary DNA was produced using TransScript All-in-One First-Strand cDNA Synthesis kit (AT341; TransGen Biotech). Transcript levels were detected with TransStart Green qPCR SuperMix (AQ111; TransGen Biotech) by using Applied Biosystems 7500 Real-Time PCR System (Life Technologies, Carlsbad, California, United States). Ubiquitin-conjugating enzyme 21 (UBC21, AT5G25760) was used as an internal control to normalize the gene expression level. The primers used in this study are listed in Supplementary Table 1.

Kan C., Zhang Y., Wang H.L., Shen Y., Xia X., Guo H, & Li Z. (2021). Transcription Factor NAC075 Delays Leaf Senescence by Deterring Reactive Oxygen Species Accumulation in Arabidopsis. Frontiers in Plant Science, 12, 634040.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using a Trizol reagent (Invitrogen), and RNA concentration was measured by spectrophotometry. Total RNA was reverse transcribed using TransScript All-in-One First-Strand cDNA Synthesis kit (TransGen Biotech, China). The PCR reaction was performed with SG Fast qPCR Master Mix (Sangon, China) using an ABI StepOnePlus Real-Time PCR System. The program included 3 min at 95°C followed by 45 melting (7 s at 95°C), annealing (10 s at 57°C), and extending (15 s at 72°C) cycles. The relative gene expression of the target genes was normalized to GAPDH expression and calculated by the 2–^ΔΔCT method and relative to control samples, which were assigned a value of 1. Each measurement was conducted using three replicates per group. The primers for the target genes are listed in Table S1.

Li D., Qu J., Yuan X., Zhuang S., Wu H., Chen R., Wu J., Zhang M, & Ying L. (2022). Mesenchymal Stem Cells Alleviate Renal Fibrosis and Inhibit Autophagy via Exosome Transfer of miRNA-122a. Stem Cells International, 2022, 1981798.

+ Open protocol

+ Expand

Total RNA Extraction and Real-Time PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA), following the manufacturer’s instructions. Along with genomic DNA (gDNA) removal, 500 ng of RNA was reverse transcribed using the TransScript All-in-One First-Strand cDNA Synthesis Kit (Transgenbiotech, Beijing, China). RT-PCR (SYBR) was performed using reagents from Transgenbiotech (Beijing, China) on a QS6 Real-Time PCR System (Applied Biosystems). Relative gene expression levels were calculated using the comparative threshold cycle (Ct) method and normalized to β-actin. The primers used for amplification are listed in Table 1.

Zhao Y., Jiang Y., Chen L., Zheng X., Zhu J., Song X., Shi J., Li Y, & He W. (2020). Inhibition of the endoplasmic reticulum (ER) stress-associated IRE-1/XBP-1 pathway alleviates acute lung injury via modulation of macrophage activation. Journal of Thoracic Disease, 12(3), 284-295.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells with TRIzol reagent (TransGen Biotech, Beijing, China). RNA was reverse transcribed using a TransScript All-in-One First-Strand cDNA Synthesis Kit (TransGen Biotech). The resulting cDNA was amplified using a reaction mix containing 10 μL of SYBR Green qPCR Master Mix (TransGen Biotech). The PCR conditions were a denaturation step at 94 °C for 5 min, followed by 40 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s. The primer sequences can be found in Table 2. The GAPDH gene was used as an internal control and the relative level of expression was determined using the 2^−ΔΔct method.Table 2

Primers used in the RT-qPCR

Gene	Forward	Reverse
MEX3C	GAAAGAGCGTCAACACCACC	AAATGGGCTCTTCACCACGA
RUNX3	AGCACCACAAGCCACTTCAG	GGGAAGGAGCGGTCAAACTG
Suv39H1	CCTGCAGGTGTACAACGTCT	ATCAAAGGTGAGCTCCTCGC
CEA	TTACCTTTCGGGAGCGAACC	GTGTGTGTTGCTGCGGTATC
SCCAg	GATGCAGACCTCTCAGGCAT	AATCCTACTACAGCGGTGGC
Ki-67	GGAAGCTGGACGCAGAAGAT	CAGCACCATTTGCCAGTTCC
PCNA	CCTGAAGCCGAAACCAGCTA	TGAGTGCCTCCAACACCTTC
GAPDH	CCAGCAAGAGCACAAGAGGA	ACATGGCAACTGTGAGGAGG

He Z., Zhang H., Xiao H., Zhang X., Xu H., Sun R, & Li S. (2024). Ubiquitylation of RUNX3 by RNA-binding ubiquitin ligase MEX3C promotes tumorigenesis in lung adenocarcinoma. Journal of Translational Medicine, 22, 216.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from samples using Trizol reagent (TransGen Biotech, Beijing, China). RNA was reverse transcribed to cDNA using TransScript All-in-One - First-strand cDNA Synthesis Kit (TransGen Biotech). Using human GAPDH gene as the internal control, cDNA was detected by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) using Applied Biosystems (USA). The final qPCR reaction mixture contained 10 μ L of Bestar® SYBR Green QPCR Master Mix. The amplification steps were as follows: denaturation at 94 °C for 5 min, amplification at 94 °C for 30s, amplification at 58 °C for 30s and amplification at 72 °C for 30s, 40 cycles in total. The reaction was stopped at 25 °C for 5 min. ABI Prism 7900HT/FAST (Applied Biosystems, USA) was used to detect and analyze its relative expression, calculated using the formula 2^−ΔΔct The RT-PCR primers were as follows. Reaction PCR primers (

Supplementary Material 1

Shen J., Yan H., Yang C., Lin H., Li F, & Zhou J. (2023). Validation of a Disease-Free Survival Prediction Model Using UBE2C and Clinical Indicators in Breast Cancer Patients. Breast Cancer : Targets and Therapy, 15, 295-310.

+ Open protocol

+ Expand

Quantifying Cell Cycle Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with the Trizol reagent (TransGen Biotech, Beijing, China) from the cells. The TransScript All-in-One First-Strand cDNA Synthesis Kit (TransGen Biotech) was used to synthesize cDNA, and qRT-PCR was conducted using the 2 × SYBR Green Master Mix (Qiagen, Germany). The relative normalized expression of the target genes was compared with that of the control gene, and the mRNA expression of each gene was calculated with the 2^−ΔΔCt method (Chen et al. 2018 (link)). The primers are as follows:

Cyclin D1 forward primer: 5′-AGGTGCTTCTGCTGTGC-3′

Cyclin D1 reverse primer: 5′-CCTTCTTCCTCCCTCACTTCTC-3′

Cyclin E forward primer: 5′-CCACCTCCATVACCACTACCA-3′

Cyclin E reverse primer: 5′-CCATTCCAACCAGAGCCACC-3′

CDK2 forward primer: 5′-AACACAGAGGGGGCCATCAAGC-3′

CDK2 reverse primer: 5′-CAGGAGCTCGGTACCACAGGGTC-3′

CDK4 forward primer: 5′-ACCAGATGGCACTTACACCC-3′

CDK4 reverse primer: 5′-TCCACAGAAGAGAGGCTTTCG-3′

Gong K., Miao S., Yang L., Wu Y., Guo J., Chen W., Dai J., Du J, & Xi S. (2020). Aaptamine attenuates the proliferation and progression of non-small cell lung carcinoma. Pharmaceutical Biology, 58(1), 1044-1054.

+ Open protocol

+ Expand

Quantification of Gene Expression in Rat Tibias

Check if the same lab product or an alternative is used in the 5 most similar protocols

Samples of three rats from each group were processed as described above for western blotting. Total RNA was extracted from proximal tibias without articular cartilage using Multisource Total RNA Prep Kits (AP-MN-MS-RNA-250, Axygen Inc., Union City, CA, USA). First-strand cDNA was synthesized using TransScript^® All-in-One First-Strand cDNA Synthesis Kit (AT341-01; TransGen Biotech, Beijing, China) and an S1000 Thermal Cycler (Bio-Rad Laboratories Inc., Hercules, CA, USA). Target genes were amplified by RT-qPCR using Perfect Start^™ Green qPCR SuperMix (Cat No. AQ602-21; TransGen Biotech, Beijing, China) and an Applied Biosystems7500 Fast Real-Time PCR System (Thermo Fisher Inc., Waltham, MA, USA) under the following conditions: 45 cycles of 94°C for 30 sec, 54°C for 30 sec, and 72°C for 34 sec. Table 1 lists the primer sequences. Relative mRNA expression levels were quantified using the 2^-ΔΔCq method. The loading control was β-actin.

Ding D., Wang L., Yan J., Zhou Y., Feng G., Ma L., Yang Y., Pei X, & Jin Q. (2022). Zoledronic acid generates a spatiotemporal effect to attenuate osteoarthritis by inhibiting potential Wnt5a-associated abnormal subchondral bone resorption. PLoS ONE, 17(7), e0271485.

+ Open protocol

+ Expand

Quantifying Gene Expression in Bullfrogs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from jejunum of bullfrogs using FastPure Tissue Total RNA Isolation Kit (Vazyme Biotech Co., Ltd, China). The purity of the total RNA was analyzed in 1% agarose gel electrophoresis, and the concentration of the total RNA was quantitated using NanoDrop One Ultramicro spectrophotometer (Thermo Fisher, United States). Total RNA was reversely transcribed to cDNA by TransScript ALL-in-one First-Strand cDNA Synthesis Kit (TransGen Biotech Co., Ltd., China). Quantitative PCR was performed on ABI StepOne Plus (Thermal Cycler, United States). The primers of the gene (Supplementary Table 2) and PCR amplification program were designed as our previous research on bullfrogs (Ding et al., 2019 ; Lin et al., 2021 (link)). The relative expression levels of genes were calculated using 2^–ΔΔCt method.

Wang Z., Zhang C., Lu K., Song K., Li X., Wang L, & Rahimnejad S. (2021). Effects of Supplementing Intestinal Autochthonous Bacteria in Plant-Based Diets on Growth, Nutrient Digestibility, and Gut Health of Bullfrogs (Lithobates catesbeianus). Frontiers in Microbiology, 12, 739572.

+ Open protocol

+ Expand

Osteoclastogenesis Regulation by Methionine

Check if the same lab product or an alternative is used in the 5 most similar protocols

BMMs were seeded into 6-well plates at a density of 1 × 10⁶ cells/well and cultured for 24 h to reach confluence. The cells were then incubated for 7 d in α-MEM containing 30 ng/mL M-CSF, 50 ng/mL RANKL, and 0, 0.1, 0.5, 1, or 2 mM Met. Multisource Total RNA Prep Kits (AP-MN-MS-RNA-250, Axygen, Union City, CA, USA) were used to extract total RNA. Complementary DNA (cDNA) was synthesized from 1 μg total RNA using a TransScript^® All-in-One First-Strand cDNA Synthesis Kit (AT341-01; TransGen Biotech) as described by the manufacturer’s instructions. RT-qPCR was subsequently performed to quantitate the expression of genes related to osteoclastogenesis. The RT-qPCR cycling conditions included 45 cycles of 94°C for 30 s, 54°C for 30 s, and 72°C for 34 s. The sequences of the primers are listed in Table 1. All reactions were run in triplicate and β-actin was used as the quantitative internal control gene.

Guo H., Ding D., Wang L., Yan J., Ma L, & Jin Q. (2021). Metformin attenuates osteoclast-mediated abnormal subchondral bone remodeling and alleviates osteoarthritis via AMPK/NF-κB/ERK signaling pathway. PLoS ONE, 16(12), e0261127.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!